Incidental Mutation 'R1232:Fbxo38'
ID152333
Institutional Source Beutler Lab
Gene Symbol Fbxo38
Ensembl Gene ENSMUSG00000042211
Gene NameF-box protein 38
Synonyms6030410I24Rik, SP329
MMRRC Submission 039301-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1232 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location62504069-62548743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62510811 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 925 (V925A)
Ref Sequence ENSEMBL: ENSMUSP00000047541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048688]
Predicted Effect probably damaging
Transcript: ENSMUST00000048688
AA Change: V925A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047541
Gene: ENSMUSG00000042211
AA Change: V925A

DomainStartEndE-ValueType
Pfam:F-box 29 66 2.6e-5 PFAM
SCOP:d1fqva2 127 357 6e-4 SMART
low complexity region 493 525 N/A INTRINSIC
low complexity region 598 610 N/A INTRINSIC
low complexity region 705 728 N/A INTRINSIC
low complexity region 736 753 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T A 1: 156,641,730 L751M probably damaging Het
Arhgap29 A G 3: 122,003,340 D525G probably damaging Het
Ces2h T C 8: 105,014,655 M93T probably benign Het
Cyp4a12b A T 4: 115,432,563 D209V possibly damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Glp1r A C 17: 30,918,931 H112P probably benign Het
Gm8251 T C 1: 44,056,592 Y1782C possibly damaging Het
Gtf3c5 A G 2: 28,571,215 W296R probably damaging Het
Ints8 A G 4: 11,234,587 I415T possibly damaging Het
Krt2 A G 15: 101,811,784 S513P probably damaging Het
Loxhd1 G A 18: 77,406,003 probably null Het
Mfsd3 A G 15: 76,703,182 Q355R probably damaging Het
Mms22l C T 4: 24,536,274 T621I probably benign Het
Olfr969 G A 9: 39,795,968 V198I probably benign Het
Pcdhb8 A G 18: 37,355,775 N169D probably benign Het
Rnls T G 19: 33,202,646 I135L probably benign Het
Sgsm1 G T 5: 113,273,711 C558* probably null Het
Spata31d1c T A 13: 65,036,614 C657S probably benign Het
Vmn2r15 T C 5: 109,293,302 D230G probably benign Het
Zfp429 T C 13: 67,390,632 Y231C possibly damaging Het
Other mutations in Fbxo38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Fbxo38 APN 18 62530800 missense possibly damaging 0.59
IGL01384:Fbxo38 APN 18 62522416 missense probably damaging 0.98
IGL01443:Fbxo38 APN 18 62533670 missense probably damaging 1.00
IGL01515:Fbxo38 APN 18 62518571 missense probably benign 0.00
IGL01621:Fbxo38 APN 18 62522524 splice site probably benign
IGL01975:Fbxo38 APN 18 62515413 missense probably damaging 1.00
IGL02148:Fbxo38 APN 18 62536227 missense probably benign 0.02
IGL02390:Fbxo38 APN 18 62533589 missense probably damaging 1.00
IGL03040:Fbxo38 APN 18 62527252 missense probably damaging 1.00
IGL03088:Fbxo38 APN 18 62522472 missense possibly damaging 0.86
IGL03290:Fbxo38 APN 18 62526163 missense probably benign 0.08
FR4976:Fbxo38 UTSW 18 62515347 small deletion probably benign
R0526:Fbxo38 UTSW 18 62505980 missense probably damaging 1.00
R0529:Fbxo38 UTSW 18 62505986 missense probably damaging 1.00
R0789:Fbxo38 UTSW 18 62515499 missense possibly damaging 0.84
R1857:Fbxo38 UTSW 18 62515418 missense probably damaging 1.00
R1859:Fbxo38 UTSW 18 62515418 missense probably damaging 1.00
R1872:Fbxo38 UTSW 18 62517023 missense probably benign 0.01
R2114:Fbxo38 UTSW 18 62506640 missense possibly damaging 0.71
R2910:Fbxo38 UTSW 18 62519807 missense probably benign 0.01
R2911:Fbxo38 UTSW 18 62519807 missense probably benign 0.01
R3406:Fbxo38 UTSW 18 62514843 missense probably damaging 0.99
R3731:Fbxo38 UTSW 18 62515328 small deletion probably benign
R3792:Fbxo38 UTSW 18 62533462 intron probably null
R3848:Fbxo38 UTSW 18 62515073 missense possibly damaging 0.87
R3948:Fbxo38 UTSW 18 62529544 splice site probably benign
R4151:Fbxo38 UTSW 18 62515328 small deletion probably benign
R4323:Fbxo38 UTSW 18 62515161 missense probably benign
R4456:Fbxo38 UTSW 18 62526249 missense probably damaging 1.00
R4786:Fbxo38 UTSW 18 62529674 missense probably damaging 1.00
R4829:Fbxo38 UTSW 18 62518591 missense probably benign
R4959:Fbxo38 UTSW 18 62522507 missense probably benign 0.45
R5274:Fbxo38 UTSW 18 62515069 missense probably damaging 0.98
R5288:Fbxo38 UTSW 18 62540971 missense probably benign
R5384:Fbxo38 UTSW 18 62540971 missense probably benign
R5385:Fbxo38 UTSW 18 62540971 missense probably benign
R5448:Fbxo38 UTSW 18 62522457 missense possibly damaging 0.59
R5540:Fbxo38 UTSW 18 62514793 critical splice donor site probably null
R5588:Fbxo38 UTSW 18 62526177 missense probably damaging 1.00
R5617:Fbxo38 UTSW 18 62505971 missense probably damaging 1.00
R5636:Fbxo38 UTSW 18 62511018 missense possibly damaging 0.80
R5769:Fbxo38 UTSW 18 62514965 missense probably benign 0.10
R6254:Fbxo38 UTSW 18 62505500 synonymous probably null
R6315:Fbxo38 UTSW 18 62536147 nonsense probably null
R6517:Fbxo38 UTSW 18 62533563 missense probably damaging 1.00
R6673:Fbxo38 UTSW 18 62533915 missense probably damaging 1.00
R6974:Fbxo38 UTSW 18 62506669 missense possibly damaging 0.95
R7022:Fbxo38 UTSW 18 62536224 missense probably damaging 1.00
R7175:Fbxo38 UTSW 18 62515473 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TCTCATGCCATGAAGCTGCTCC -3'
(R):5'- CTGTGATTGAAGATGACCACGTACAGG -3'

Sequencing Primer
(F):5'- gcaaagcagcaaacactctac -3'
(R):5'- CACGTACAGGTAAAGAAGAAAGCTC -3'
Posted On2014-01-29