Incidental Mutation 'R1233:Exosc8'
ID152341
Institutional Source Beutler Lab
Gene Symbol Exosc8
Ensembl Gene ENSMUSG00000027752
Gene Nameexosome component 8
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R1233 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location54728678-54735393 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54731998 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 129 (C129S)
Ref Sequence ENSEMBL: ENSMUSP00000118780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029315] [ENSMUST00000029316] [ENSMUST00000044567] [ENSMUST00000141191] [ENSMUST00000153224] [ENSMUST00000154787] [ENSMUST00000155273] [ENSMUST00000197502] [ENSMUST00000199674] [ENSMUST00000200439] [ENSMUST00000200441]
Predicted Effect probably benign
Transcript: ENSMUST00000029315
SMART Domains Protein: ENSMUSP00000029315
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 107 159 N/A INTRINSIC
coiled coil region 201 230 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000029316
AA Change: C125S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029316
Gene: ENSMUSG00000027752
AA Change: C125S

DomainStartEndE-ValueType
Pfam:RNase_PH 31 166 2.3e-29 PFAM
Pfam:RNase_PH_C 191 258 8.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044567
SMART Domains Protein: ENSMUSP00000035879
Gene: ENSMUSG00000036632

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 63 174 2.1e-10 PFAM
Pfam:Glycos_transf_2 68 250 2.9e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140935
Predicted Effect probably benign
Transcript: ENSMUST00000141191
SMART Domains Protein: ENSMUSP00000118818
Gene: ENSMUSG00000036632

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150923
Predicted Effect probably benign
Transcript: ENSMUST00000153224
AA Change: C129S

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118780
Gene: ENSMUSG00000027752
AA Change: C129S

DomainStartEndE-ValueType
Pfam:RNase_PH 31 130 2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154787
SMART Domains Protein: ENSMUSP00000115876
Gene: ENSMUSG00000027752

DomainStartEndE-ValueType
Pfam:RNase_PH 19 106 5.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155273
SMART Domains Protein: ENSMUSP00000119260
Gene: ENSMUSG00000036632

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197502
SMART Domains Protein: ENSMUSP00000143750
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 62 227 1.9e-43 PFAM
low complexity region 424 440 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 487 501 N/A INTRINSIC
low complexity region 512 532 N/A INTRINSIC
low complexity region 574 587 N/A INTRINSIC
low complexity region 632 680 N/A INTRINSIC
coiled coil region 722 751 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198780
Predicted Effect probably benign
Transcript: ENSMUST00000199674
SMART Domains Protein: ENSMUSP00000142948
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 227 3.3e-39 PFAM
low complexity region 424 442 N/A INTRINSIC
low complexity region 466 475 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200439
SMART Domains Protein: ENSMUSP00000143059
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 227 2.7e-42 PFAM
low complexity region 424 440 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 487 501 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200441
SMART Domains Protein: ENSMUSP00000143231
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 123 171 N/A INTRINSIC
coiled coil region 213 242 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 3'-5' exoribonuclease that specifically interacts with mRNAs containing AU-rich elements. The encoded protein is part of the exosome complex that is important for the degradation of numerous RNA species. A pseudogene of this gene is found on chromosome 6. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,199,520 M631K probably damaging Het
Ache A G 5: 137,290,157 probably null Het
Arfgef1 T C 1: 10,184,090 D773G probably damaging Het
Arhgap45 T C 10: 80,027,582 I753T probably damaging Het
Cd274 T A 19: 29,373,901 probably null Het
Cdh16 C T 8: 104,618,482 A392T possibly damaging Het
Csmd3 T C 15: 48,673,531 T92A probably damaging Het
Fat3 T G 9: 15,922,745 I4184L probably benign Het
Frem2 A G 3: 53,547,778 Y2126H probably damaging Het
Fsbp T C 4: 11,580,053 M107T possibly damaging Het
Gper1 A G 5: 139,426,602 Y234C probably damaging Het
Hmcn1 T C 1: 150,749,026 S1043G probably benign Het
Kif2a T A 13: 106,987,332 K137N probably damaging Het
Mrc2 T C 11: 105,348,415 F1332S probably damaging Het
Nme8 T A 13: 19,660,512 M375L possibly damaging Het
Olfr392 T A 11: 73,814,350 H244L probably damaging Het
Per1 T C 11: 69,102,211 L298P probably damaging Het
Polr2b A G 5: 77,334,565 N650S probably benign Het
Ppara T C 15: 85,798,021 V306A probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Repin1 A G 6: 48,597,834 T566A possibly damaging Het
Rhot2 T A 17: 25,844,097 D57V probably damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Slc5a8 C A 10: 88,918,442 P435H probably damaging Het
Stpg1 G A 4: 135,525,429 A164T probably benign Het
Tll2 G T 19: 41,095,984 A668D possibly damaging Het
Txnl1 T A 18: 63,675,468 M180L probably benign Het
Vopp1 A C 6: 57,789,995 L32R probably damaging Het
Wdr95 C T 5: 149,581,858 T226I possibly damaging Het
Wdr95 C A 5: 149,595,364 Q557K probably benign Het
Other mutations in Exosc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Exosc8 APN 3 54729265 missense probably damaging 0.97
IGL03348:Exosc8 APN 3 54732722 missense possibly damaging 0.91
R1037:Exosc8 UTSW 3 54732738 missense probably damaging 0.98
R1623:Exosc8 UTSW 3 54734331 missense probably damaging 0.99
R1647:Exosc8 UTSW 3 54734101 critical splice donor site probably null
R1928:Exosc8 UTSW 3 54728845 missense probably damaging 1.00
R3005:Exosc8 UTSW 3 54732147 synonymous probably null
R4851:Exosc8 UTSW 3 54732102 unclassified probably benign
R4932:Exosc8 UTSW 3 54729290 missense possibly damaging 0.81
R5010:Exosc8 UTSW 3 54729223 missense probably benign 0.00
R5506:Exosc8 UTSW 3 54731179 unclassified probably benign
R5860:Exosc8 UTSW 3 54735042 unclassified probably benign
R6887:Exosc8 UTSW 3 54733699 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGCTACGTTAGCCAGTGAAAG -3'
(R):5'- GAGGCTCAAGTAACCAGCCAGTTC -3'

Sequencing Primer
(F):5'- gatacagaaggaggagggaaag -3'
(R):5'- CAGCCAGTTCATTGCAGATG -3'
Posted On2014-01-29