Mutagenetix > Incidental Mutation

Incidental Mutation 'R1233:Ache'

152345

Institutional Source

Beutler Lab

Gene Symbol

Ache

Ensembl Gene

ENSMUSG00000023328

Gene Name

acetylcholinesterase

Synonyms

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.685) question?

Stock #

R1233 (G1)

Quality Score

219

Status

Not validated

Chromosome

Chromosomal Location

137286516-137292728 bp(+) (GRCm39)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

A to G at 137288419 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000123295 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024099] [ENSMUST00000052825] [ENSMUST00000085934] [ENSMUST00000125195] [ENSMUST00000132191] [ENSMUST00000137126] [ENSMUST00000138591] [ENSMUST00000196208] [ENSMUST00000141123]

AlphaFold

P21836

Predicted Effect

probably benign
Transcript: ENSMUST00000024099
AA Change: R42G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000024099
Gene: ENSMUSG00000023328
AA Change: R42G

Domain	Start	End	E-Value	Type
Pfam:COesterase	14	563	2e-186	PFAM
Pfam:Abhydrolase_3	146	276	7.5e-9	PFAM
Pfam:AChE_tetra	578	614	3.2e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000052825

SMART Domains

Protein: ENSMUSP00000056156
Gene: ENSMUSG00000051502

Domain	Start	End	E-Value	Type
Pfam:Peptidase_C78	27	212	5.4e-37	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000085934
AA Change: R42G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000083097
Gene: ENSMUSG00000023328
AA Change: R42G

Domain	Start	End	E-Value	Type
Pfam:COesterase	15	563	3e-178	PFAM
Pfam:Abhydrolase_3	146	260	1.4e-7	PFAM
Pfam:AChE_tetra	578	613	3.2e-23	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000125195

Predicted Effect

probably null
Transcript: ENSMUST00000132191

Predicted Effect

probably null
Transcript: ENSMUST00000137126

Predicted Effect

probably null
Transcript: ENSMUST00000138591

Predicted Effect

probably benign
Transcript: ENSMUST00000196208
AA Change: R42G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000142427
Gene: ENSMUSG00000023328
AA Change: R42G

Domain	Start	End	E-Value	Type
Pfam:COesterase	14	359	6.5e-134	PFAM
Pfam:Abhydrolase_3	146	284	4.1e-7	PFAM
Pfam:COesterase	355	475	1.5e-25	PFAM
Pfam:AChE_tetra	490	526	2.2e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150983

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196840

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184134

Predicted Effect

probably null
Transcript: ENSMUST00000141123

Coding Region Coverage

1x: 99.2%
3x: 98.3%
10x: 95.9%
20x: 90.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetylcholinesterase hydrolyzes the neurotransmitter, acetylcholine at neuromuscular junctions and brain cholinergic synapses, and thus terminates signal transmission. It is also found on the red blood cell membranes, where it constitutes the Yt blood group antigen. Acetylcholinesterase exists in multiple molecular forms which possess similar catalytic properties, but differ in their oligomeric assembly and mode of cell attachment to the cell surface. It is encoded by the single ACHE gene, and the structural diversity in the gene products arises from alternative mRNA splicing, and post-translational associations of catalytic and structural subunits. The major form of acetylcholinesterase found in brain, muscle and other tissues is the hydrophilic species, which forms disulfide-linked oligomers with collagenous, or lipid-containing structural subunits. The other, alternatively spliced form, expressed primarily in the erythroid tissues, differs at the C-terminal end, and contains a cleavable hydrophobic peptide with a GPI-anchor site. It associates with the membranes through the phosphoinositide (PI) moieties added post-translationally. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show retarded postnatal development, tremors, impaired righting response, delayed maturation of external ear, failure of eyelids to open, and die by 3-wk. of age. Mutants are highly sensitive to butyrylcholinesterase inhibitor toxicity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aopep	T	A	13: 63,347,334 (GRCm39)	M631K	probably damaging	Het
Arfgef1	T	C	1: 10,254,315 (GRCm39)	D773G	probably damaging	Het
Arhgap45	T	C	10: 79,863,416 (GRCm39)	I753T	probably damaging	Het
Cd274	T	A	19: 29,351,301 (GRCm39)		probably null	Het
Cdh16	C	T	8: 105,345,114 (GRCm39)	A392T	possibly damaging	Het
Csmd3	T	C	15: 48,536,927 (GRCm39)	T92A	probably damaging	Het
Exosc8	A	T	3: 54,639,419 (GRCm39)	C129S	probably benign	Het
Fat3	T	G	9: 15,834,041 (GRCm39)	I4184L	probably benign	Het
Frem2	A	G	3: 53,455,199 (GRCm39)	Y2126H	probably damaging	Het
Fsbp	T	C	4: 11,580,053 (GRCm39)	M107T	possibly damaging	Het
Gper1	A	G	5: 139,412,357 (GRCm39)	Y234C	probably damaging	Het
Hmcn1	T	C	1: 150,624,777 (GRCm39)	S1043G	probably benign	Het
Kif2a	T	A	13: 107,123,840 (GRCm39)	K137N	probably damaging	Het
Mrc2	T	C	11: 105,239,241 (GRCm39)	F1332S	probably damaging	Het
Nme8	T	A	13: 19,844,682 (GRCm39)	M375L	possibly damaging	Het
Or1e32	T	A	11: 73,705,176 (GRCm39)	H244L	probably damaging	Het
Per1	T	C	11: 68,993,037 (GRCm39)	L298P	probably damaging	Het
Polr2b	A	G	5: 77,482,412 (GRCm39)	N650S	probably benign	Het
Ppara	T	C	15: 85,682,222 (GRCm39)	V306A	probably damaging	Het
Rem1	G	A	2: 152,476,455 (GRCm39)	V238M	probably damaging	Het
Repin1	A	G	6: 48,574,768 (GRCm39)	T566A	possibly damaging	Het
Rhot2	T	A	17: 26,063,071 (GRCm39)	D57V	probably damaging	Het
Samd4b	C	T	7: 28,113,435 (GRCm39)	G177R	probably damaging	Het
Slc5a8	C	A	10: 88,754,304 (GRCm39)	P435H	probably damaging	Het
Stpg1	G	A	4: 135,252,740 (GRCm39)	A164T	probably benign	Het
Tll2	G	T	19: 41,084,423 (GRCm39)	A668D	possibly damaging	Het
Txnl1	T	A	18: 63,808,539 (GRCm39)	M180L	probably benign	Het
Vopp1	A	C	6: 57,766,980 (GRCm39)	L32R	probably damaging	Het
Wdr95	C	T	5: 149,505,323 (GRCm39)	T226I	possibly damaging	Het
Wdr95	C	A	5: 149,518,829 (GRCm39)	Q557K	probably benign	Het

Other mutations in Ache

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02323:Ache	APN	5	137,289,326 (GRCm39)	missense	probably damaging	1.00
IGL02833:Ache	APN	5	137,289,371 (GRCm39)	unclassified	probably benign
R0058:Ache	UTSW	5	137,289,104 (GRCm39)	missense	probably damaging	1.00
R0358:Ache	UTSW	5	137,288,635 (GRCm39)	missense	probably benign	0.21
R0377:Ache	UTSW	5	137,289,190 (GRCm39)	missense	possibly damaging	0.54
R0780:Ache	UTSW	5	137,288,794 (GRCm39)	missense	probably damaging	1.00
R1702:Ache	UTSW	5	137,289,251 (GRCm39)	missense	possibly damaging	0.94
R1762:Ache	UTSW	5	137,288,837 (GRCm39)	missense	possibly damaging	0.91
R4191:Ache	UTSW	5	137,289,334 (GRCm39)	missense	probably damaging	0.98
R4226:Ache	UTSW	5	137,289,152 (GRCm39)	missense	possibly damaging	0.83
R4499:Ache	UTSW	5	137,290,194 (GRCm39)	missense	probably damaging	0.98
R4931:Ache	UTSW	5	137,290,176 (GRCm39)	missense	probably benign	0.00
R5411:Ache	UTSW	5	137,288,692 (GRCm39)	splice site	probably null
R5411:Ache	UTSW	5	137,288,326 (GRCm39)	missense	possibly damaging	0.93
R5698:Ache	UTSW	5	137,288,821 (GRCm39)	missense	probably damaging	1.00
R6153:Ache	UTSW	5	137,290,117 (GRCm39)	missense	probably damaging	1.00
R6526:Ache	UTSW	5	137,288,906 (GRCm39)	missense	probably damaging	1.00
R6896:Ache	UTSW	5	137,289,996 (GRCm39)	missense	probably damaging	0.98
R6981:Ache	UTSW	5	137,289,940 (GRCm39)	missense	probably benign
R7199:Ache	UTSW	5	137,288,504 (GRCm39)	missense	probably damaging	1.00
R7208:Ache	UTSW	5	137,289,751 (GRCm39)	missense	probably damaging	1.00
R8200:Ache	UTSW	5	137,292,457 (GRCm39)	missense	probably damaging	1.00
R8338:Ache	UTSW	5	137,290,006 (GRCm39)	missense	probably damaging	1.00
R8461:Ache	UTSW	5	137,288,582 (GRCm39)	missense	probably damaging	0.96
R8933:Ache	UTSW	5	137,288,449 (GRCm39)	missense	possibly damaging	0.56
R9146:Ache	UTSW	5	137,289,077 (GRCm39)	missense	probably damaging	1.00
R9376:Ache	UTSW	5	137,289,025 (GRCm39)	missense	probably benign
R9439:Ache	UTSW	5	137,289,185 (GRCm39)	missense	probably damaging	0.97
X0061:Ache	UTSW	5	137,288,357 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCTGCAACTCCTTGATAAGCCCTG -3'
(R):5'- GGAAGGTGGTAGCATCCAACACTC -3'

Sequencing Primer
(F):5'- CTGGGCAAGACTGTTTCTTAATC -3'
(R):5'- GGTAGCATCCAACACTCCTGAC -3'

Posted On

2014-01-29