Incidental Mutation 'R1233:2010111I01Rik'
ID152362
Institutional Source Beutler Lab
Gene Symbol 2010111I01Rik
Ensembl Gene ENSMUSG00000021458
Gene NameRIKEN cDNA 2010111I01 gene
SynonymsApO, aminopeptidase O
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R1233 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location62964893-63326096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63199520 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 631 (M631K)
Ref Sequence ENSEMBL: ENSMUSP00000089148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021911] [ENSMUST00000091560]
Predicted Effect probably damaging
Transcript: ENSMUST00000021911
AA Change: M630K

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021911
Gene: ENSMUSG00000021458
AA Change: M630K

DomainStartEndE-ValueType
low complexity region 143 154 N/A INTRINSIC
Pfam:Peptidase_M1 221 359 5.4e-11 PFAM
Pfam:Peptidase_M1 385 558 2.3e-15 PFAM
Pfam:Peptidase_MA_2 453 613 1.3e-12 PFAM
Leuk-A4-hydro_C 675 821 3.02e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091560
AA Change: M631K

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000089148
Gene: ENSMUSG00000021458
AA Change: M631K

DomainStartEndE-ValueType
low complexity region 143 154 N/A INTRINSIC
Pfam:Peptidase_M1 220 359 2.7e-11 PFAM
Pfam:Peptidase_M1 386 561 1.9e-15 PFAM
Leuk-A4-hydro_C 676 822 3.02e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220457
Predicted Effect unknown
Transcript: ENSMUST00000220863
AA Change: M522K
Predicted Effect probably benign
Transcript: ENSMUST00000221676
Predicted Effect unknown
Transcript: ENSMUST00000222282
AA Change: M25K
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M1 zinc aminopeptidase family. The encoded protein is a zinc-dependent metallopeptidase that catalyzes the removal of an amino acid from the amino terminus of a protein or peptide. This protein may play a role in the generation of angiotensin IV. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for one gene trapped allele are phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ache A G 5: 137,290,157 probably null Het
Arfgef1 T C 1: 10,184,090 D773G probably damaging Het
Arhgap45 T C 10: 80,027,582 I753T probably damaging Het
Cd274 T A 19: 29,373,901 probably null Het
Cdh16 C T 8: 104,618,482 A392T possibly damaging Het
Csmd3 T C 15: 48,673,531 T92A probably damaging Het
Exosc8 A T 3: 54,731,998 C129S probably benign Het
Fat3 T G 9: 15,922,745 I4184L probably benign Het
Frem2 A G 3: 53,547,778 Y2126H probably damaging Het
Fsbp T C 4: 11,580,053 M107T possibly damaging Het
Gper1 A G 5: 139,426,602 Y234C probably damaging Het
Hmcn1 T C 1: 150,749,026 S1043G probably benign Het
Kif2a T A 13: 106,987,332 K137N probably damaging Het
Mrc2 T C 11: 105,348,415 F1332S probably damaging Het
Nme8 T A 13: 19,660,512 M375L possibly damaging Het
Olfr392 T A 11: 73,814,350 H244L probably damaging Het
Per1 T C 11: 69,102,211 L298P probably damaging Het
Polr2b A G 5: 77,334,565 N650S probably benign Het
Ppara T C 15: 85,798,021 V306A probably damaging Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Repin1 A G 6: 48,597,834 T566A possibly damaging Het
Rhot2 T A 17: 25,844,097 D57V probably damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Slc5a8 C A 10: 88,918,442 P435H probably damaging Het
Stpg1 G A 4: 135,525,429 A164T probably benign Het
Tll2 G T 19: 41,095,984 A668D possibly damaging Het
Txnl1 T A 18: 63,675,468 M180L probably benign Het
Vopp1 A C 6: 57,789,995 L32R probably damaging Het
Wdr95 C T 5: 149,581,858 T226I possibly damaging Het
Wdr95 C A 5: 149,595,364 Q557K probably benign Het
Other mutations in 2010111I01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:2010111I01Rik APN 13 63199500 splice site probably benign
IGL00329:2010111I01Rik APN 13 63191163 missense probably damaging 1.00
IGL00336:2010111I01Rik APN 13 63015423 missense possibly damaging 0.78
IGL01384:2010111I01Rik APN 13 63190476 splice site probably benign
IGL01780:2010111I01Rik APN 13 63210125 missense probably benign 0.00
IGL01876:2010111I01Rik APN 13 63190522 missense probably damaging 1.00
IGL02096:2010111I01Rik APN 13 63061089 missense probably benign 0.04
IGL02166:2010111I01Rik APN 13 63015453 missense probably benign 0.02
IGL02184:2010111I01Rik APN 13 63068111 missense possibly damaging 0.50
R0139:2010111I01Rik UTSW 13 63190484 missense probably benign 0.01
R1209:2010111I01Rik UTSW 13 63191064 unclassified probably null
R1756:2010111I01Rik UTSW 13 63068061 missense possibly damaging 0.95
R1786:2010111I01Rik UTSW 13 63210149 missense probably benign 0.00
R1861:2010111I01Rik UTSW 13 63015783 missense probably damaging 1.00
R2130:2010111I01Rik UTSW 13 63210149 missense probably benign 0.00
R2131:2010111I01Rik UTSW 13 63210149 missense probably benign 0.00
R3076:2010111I01Rik UTSW 13 63240115 missense probably damaging 0.96
R3702:2010111I01Rik UTSW 13 63015330 missense probably benign 0.01
R3912:2010111I01Rik UTSW 13 63156706 nonsense probably null
R4512:2010111I01Rik UTSW 13 63156667 missense probably damaging 0.99
R4593:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4596:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4597:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4616:2010111I01Rik UTSW 13 63298751 missense probably damaging 1.00
R4625:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4627:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4630:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4632:2010111I01Rik UTSW 13 63068092 missense probably benign 0.01
R4911:2010111I01Rik UTSW 13 63170939 critical splice acceptor site probably null
R5204:2010111I01Rik UTSW 13 63033090 missense probably benign 0.15
R5210:2010111I01Rik UTSW 13 63068110 missense probably benign 0.00
R5849:2010111I01Rik UTSW 13 63015498 missense probably benign 0.00
R5861:2010111I01Rik UTSW 13 63298812 missense probably damaging 1.00
R5960:2010111I01Rik UTSW 13 63240273 missense probably damaging 0.99
R6021:2010111I01Rik UTSW 13 63061082 missense probably damaging 1.00
R6048:2010111I01Rik UTSW 13 63240325 missense probably damaging 0.99
R6379:2010111I01Rik UTSW 13 63068243 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCCCTAGCACAGTTGGGCAGTTAT -3'
(R):5'- CCTAAGGTCCTTGGTACAGAGAGGAAAT -3'

Sequencing Primer
(F):5'- tccttcagtcctttctctaatcc -3'
(R):5'- CTTGGTACAGAGAGGAAATCTCAAC -3'
Posted On2014-01-29