Incidental Mutation 'R1234:Xrcc1'
ID 152384
Institutional Source Beutler Lab
Gene Symbol Xrcc1
Ensembl Gene ENSMUSG00000051768
Gene Name X-ray repair complementing defective repair in Chinese hamster cells 1
Synonyms Xrcc-1
MMRRC Submission 039302-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1234 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 24246124-24272863 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24267270 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 373 (V373A)
Ref Sequence ENSEMBL: ENSMUSP00000146105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063249] [ENSMUST00000205573]
AlphaFold Q60596
Predicted Effect possibly damaging
Transcript: ENSMUST00000063249
AA Change: V373A

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000070995
Gene: ENSMUSG00000051768
AA Change: V373A

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 151 6.9e-66 PFAM
low complexity region 212 238 N/A INTRINSIC
low complexity region 278 294 N/A INTRINSIC
BRCT 317 393 8e-19 SMART
low complexity region 407 424 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
BRCT 538 617 5.5e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205564
Predicted Effect possibly damaging
Transcript: ENSMUST00000205573
AA Change: V373A

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206429
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the efficient repair of DNA single-strand breaks formed by exposure to ionizing radiation and alkylating agents. This protein interacts with DNA ligase III, polymerase beta and poly (ADP-ribose) polymerase to participate in the base excision repair pathway. It may play a role in DNA processing during meiogenesis and recombination in germ cells. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants accumulate unrepaired DNA strand breaks in the egg cylinder, show increased cell death in epiblast, developmental arrest at embryonic day 6.5, morphological anomalies in visceral embryonic endoderm by day 7.5 and die by day 8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccn1 A G 3: 145,355,594 (GRCm39) probably benign Het
Cd300e T A 11: 114,946,192 (GRCm39) I90F probably damaging Het
Dclk1 T C 3: 55,397,298 (GRCm39) I528T probably damaging Het
Dnajc13 T C 9: 104,091,356 (GRCm39) N645S possibly damaging Het
Efhb A T 17: 53,758,615 (GRCm39) Y340* probably null Het
Fhod1 T C 8: 106,063,795 (GRCm39) probably benign Het
Hk2 G A 6: 82,737,229 (GRCm39) H28Y possibly damaging Het
Hmcn1 G A 1: 150,629,405 (GRCm39) R951* probably null Het
Insyn1 AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,406,715 (GRCm39) probably benign Het
Mapkapk2 G A 1: 130,983,513 (GRCm39) R334* probably null Het
Nckap1 C T 2: 80,348,286 (GRCm39) S889N probably benign Het
Psg18 A T 7: 18,083,115 (GRCm39) S347T probably damaging Het
Ptk6 C T 2: 180,844,233 (GRCm39) R22Q possibly damaging Het
Samd4b C T 7: 28,113,435 (GRCm39) G177R probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Ssrp1 T C 2: 84,872,607 (GRCm39) F415S probably damaging Het
Stab1 A G 14: 30,872,193 (GRCm39) L1198P probably damaging Het
Tcf23 T C 5: 31,127,566 (GRCm39) Y123H probably damaging Het
Vars2 T C 17: 35,978,038 (GRCm39) N43S probably damaging Het
Vmn2r79 A T 7: 86,653,307 (GRCm39) E524V possibly damaging Het
Other mutations in Xrcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Xrcc1 APN 7 24,247,309 (GRCm39) critical splice donor site probably null
IGL01830:Xrcc1 APN 7 24,272,767 (GRCm39) utr 3 prime probably benign
IGL02349:Xrcc1 APN 7 24,266,467 (GRCm39) nonsense probably null
IGL02433:Xrcc1 APN 7 24,264,979 (GRCm39) missense possibly damaging 0.96
IGL03131:Xrcc1 APN 7 24,272,719 (GRCm39) nonsense probably null
Bilberry UTSW 7 24,269,643 (GRCm39) missense probably damaging 1.00
R0090:Xrcc1 UTSW 7 24,269,642 (GRCm39) missense probably damaging 0.99
R0517:Xrcc1 UTSW 7 24,269,744 (GRCm39) splice site probably benign
R0612:Xrcc1 UTSW 7 24,269,744 (GRCm39) splice site probably benign
R1577:Xrcc1 UTSW 7 24,265,052 (GRCm39) nonsense probably null
R1796:Xrcc1 UTSW 7 24,247,252 (GRCm39) missense probably damaging 1.00
R1863:Xrcc1 UTSW 7 24,270,000 (GRCm39) missense possibly damaging 0.65
R3788:Xrcc1 UTSW 7 24,266,333 (GRCm39) missense probably benign 0.08
R3794:Xrcc1 UTSW 7 24,269,985 (GRCm39) missense probably benign 0.05
R4806:Xrcc1 UTSW 7 24,269,905 (GRCm39) missense probably benign 0.14
R5206:Xrcc1 UTSW 7 24,266,988 (GRCm39) missense probably damaging 1.00
R5414:Xrcc1 UTSW 7 24,269,643 (GRCm39) missense probably damaging 1.00
R5532:Xrcc1 UTSW 7 24,267,353 (GRCm39) critical splice donor site probably null
R5624:Xrcc1 UTSW 7 24,259,270 (GRCm39) missense possibly damaging 0.57
R5990:Xrcc1 UTSW 7 24,267,293 (GRCm39) missense probably damaging 1.00
R6603:Xrcc1 UTSW 7 24,270,459 (GRCm39) nonsense probably null
R6669:Xrcc1 UTSW 7 24,246,762 (GRCm39) missense probably damaging 1.00
R6716:Xrcc1 UTSW 7 24,266,571 (GRCm39) critical splice donor site probably null
R6881:Xrcc1 UTSW 7 24,246,776 (GRCm39) nonsense probably null
R7227:Xrcc1 UTSW 7 24,246,757 (GRCm39) missense probably damaging 1.00
R8204:Xrcc1 UTSW 7 24,271,709 (GRCm39) missense possibly damaging 0.88
R8284:Xrcc1 UTSW 7 24,271,703 (GRCm39) missense probably damaging 1.00
R8285:Xrcc1 UTSW 7 24,271,703 (GRCm39) missense probably damaging 1.00
R8287:Xrcc1 UTSW 7 24,271,703 (GRCm39) missense probably damaging 1.00
R9015:Xrcc1 UTSW 7 24,271,642 (GRCm39) missense probably benign 0.05
R9607:Xrcc1 UTSW 7 24,265,690 (GRCm39) missense probably benign 0.17
X0019:Xrcc1 UTSW 7 24,272,553 (GRCm39) missense probably damaging 1.00
X0024:Xrcc1 UTSW 7 24,272,504 (GRCm39) missense probably damaging 1.00
Z1176:Xrcc1 UTSW 7 24,247,264 (GRCm39) missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- CCAGACAGCACACATCTCATGTAGG -3'
(R):5'- TGGCACCCAAAGGATGCCAAAG -3'

Sequencing Primer
(F):5'- tgccctgccctaccctg -3'
(R):5'- TCAGTTCTGAGGAATGGCATAC -3'
Posted On 2014-01-29