Incidental Mutation 'R1234:6030419C18Rik'
List |< first << previous [record 18 of 585] next >> last >|
ID152388
Institutional Source Beutler Lab
Gene Symbol 6030419C18Rik
Ensembl Gene ENSMUSG00000066607
Gene NameRIKEN cDNA 6030419C18 gene
Synonyms
MMRRC Submission 039302-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R1234 (G1)
Quality Score101
Status Not validated
Chromosome9
Chromosomal Location58488603-58499780 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) AGAGGAGGAGGAGGAGG to AGAGGAGGAGGAGG at 58499432 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085658] [ENSMUST00000216294]
Predicted Effect probably benign
Transcript: ENSMUST00000085658
SMART Domains Protein: ENSMUSP00000082800
Gene: ENSMUSG00000066607

DomainStartEndE-ValueType
Pfam:DUF4589 52 279 2e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216294
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd300e T A 11: 115,055,366 I90F probably damaging Het
Cyr61 A G 3: 145,649,839 probably benign Het
Dclk1 T C 3: 55,489,877 I528T probably damaging Het
Dnajc13 T C 9: 104,214,157 N645S possibly damaging Het
Efhb A T 17: 53,451,587 Y340* probably null Het
Fhod1 T C 8: 105,337,163 probably benign Het
Hk2 G A 6: 82,760,248 H28Y possibly damaging Het
Hmcn1 G A 1: 150,753,654 R951* probably null Het
Mapkapk2 G A 1: 131,055,776 R334* probably null Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Psg18 A T 7: 18,349,190 S347T probably damaging Het
Ptk6 C T 2: 181,202,440 R22Q possibly damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Ssrp1 T C 2: 85,042,263 F415S probably damaging Het
Stab1 A G 14: 31,150,236 L1198P probably damaging Het
Tcf23 T C 5: 30,970,222 Y123H probably damaging Het
Vars2 T C 17: 35,667,146 N43S probably damaging Het
Vmn2r79 A T 7: 87,004,099 E524V possibly damaging Het
Xrcc1 T C 7: 24,567,845 V373A possibly damaging Het
Other mutations in 6030419C18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03367:6030419C18Rik APN 9 58499098 missense probably damaging 1.00
R1367:6030419C18Rik UTSW 9 58498980 missense probably damaging 1.00
R1385:6030419C18Rik UTSW 9 58499432 small deletion probably benign
R1615:6030419C18Rik UTSW 9 58499068 missense probably damaging 0.96
R1850:6030419C18Rik UTSW 9 58499109 missense probably benign
R2088:6030419C18Rik UTSW 9 58499005 missense probably damaging 1.00
R3943:6030419C18Rik UTSW 9 58499432 small deletion probably benign
R3955:6030419C18Rik UTSW 9 58499623 missense probably damaging 1.00
R4614:6030419C18Rik UTSW 9 58499432 small deletion probably benign
R6164:6030419C18Rik UTSW 9 58499247 missense probably damaging 0.96
R6622:6030419C18Rik UTSW 9 58499250 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACTTTGAACTGGAGCCAGATGAC -3'
(R):5'- AGTGCTGCTGTTCCTTGTGACC -3'

Sequencing Primer
(F):5'- GGCTGATATCCTCTCAGACAG -3'
(R):5'- GTTCCTTGTGACCCTCCG -3'
Posted On2014-01-29