Incidental Mutation 'R1237:Chd1l'
List |< first << previous [record 9 of 39] next >> last >|
ID152451
Institutional Source Beutler Lab
Gene Symbol Chd1l
Ensembl Gene ENSMUSG00000028089
Gene Namechromodomain helicase DNA binding protein 1-like
Synonyms4432404A22Rik, Snf2p
MMRRC Submission 039304-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R1237 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location97560742-97610203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97582731 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 503 (E503K)
Ref Sequence ENSEMBL: ENSMUSP00000029730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029730]
Predicted Effect probably benign
Transcript: ENSMUST00000029730
AA Change: E503K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000029730
Gene: ENSMUSG00000028089
AA Change: E503K

DomainStartEndE-ValueType
DEXDc 36 224 1.83e-38 SMART
HELICc 371 453 7.45e-21 SMART
low complexity region 548 570 N/A INTRINSIC
coiled coil region 643 680 N/A INTRINSIC
low complexity region 692 709 N/A INTRINSIC
PDB:2FG1|A 718 878 6e-9 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197304
Meta Mutation Damage Score 0.1028 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA helicase protein involved in DNA repair. The protein converts ATP to add poly(ADP-ribose) as it regulates chromatin relaxation following DNA damage. Overexpression of this gene has been linked to several types of cancers. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,948,357 T500A probably damaging Het
Amz1 A T 5: 140,741,284 M1L probably damaging Het
Angptl1 T A 1: 156,858,584 N413K probably damaging Het
Ankrd13b T C 11: 77,474,574 T70A probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Ccdc174 C T 6: 91,890,787 probably benign Het
Ccnc T A 4: 21,730,457 F31L probably benign Het
Celsr1 A C 15: 85,903,974 S2692R probably benign Het
Ddhd1 A T 14: 45,601,650 D65E probably benign Het
Dync1h1 A G 12: 110,665,959 N4504S probably benign Het
Enthd1 A G 15: 80,534,598 S167P probably damaging Het
Fat1 A T 8: 45,044,279 Y4267F probably damaging Het
Hectd4 C T 5: 121,321,507 A813V possibly damaging Het
Ibtk T C 9: 85,720,748 S735G probably benign Het
Itga4 A G 2: 79,279,146 I230V probably null Het
Kcnh8 A T 17: 52,893,960 Q474L probably damaging Het
Kcnh8 G T 17: 52,893,961 Q474H probably damaging Het
Mib1 C T 18: 10,768,149 T466I probably damaging Het
Olfr101 T A 17: 37,300,265 R52S probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr167 A C 16: 19,515,625 Y4D probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Prdx6b A G 2: 80,293,176 I110V probably benign Het
Prf1 A C 10: 61,303,649 D462A probably benign Het
Rps6ka5 T C 12: 100,575,705 D391G possibly damaging Het
Scn7a A T 2: 66,680,295 N1254K probably damaging Het
Skor2 A T 18: 76,876,132 K924* probably null Het
Slc22a21 A G 11: 53,979,772 I29T probably benign Het
Tas2r140 T C 6: 133,055,208 T196A probably benign Het
Thrap3 A G 4: 126,180,069 S295P probably benign Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Ubtd2 C T 11: 32,516,125 R115W probably damaging Het
Unc93b1 A G 19: 3,935,228 E12G possibly damaging Het
Vgll3 T A 16: 65,839,573 Y203* probably null Het
Vmn1r212 G A 13: 22,883,468 Q232* probably null Het
Vmn2r107 T A 17: 20,356,685 L315* probably null Het
Vmn2r84 T A 10: 130,387,856 probably null Het
Washc5 A G 15: 59,338,908 probably benign Het
Other mutations in Chd1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Chd1l APN 3 97590605 missense probably damaging 1.00
IGL01349:Chd1l APN 3 97591234 missense probably benign 0.07
IGL02115:Chd1l APN 3 97589904 critical splice donor site probably null
IGL02418:Chd1l APN 3 97581099 missense probably benign 0.39
IGL02717:Chd1l APN 3 97583907 missense probably damaging 1.00
IGL03091:Chd1l APN 3 97563547 missense probably damaging 1.00
IGL03048:Chd1l UTSW 3 97597763 missense probably benign 0.01
R0125:Chd1l UTSW 3 97587149 missense probably benign 0.00
R0702:Chd1l UTSW 3 97566794 missense probably benign 0.05
R1226:Chd1l UTSW 3 97562625 nonsense probably null
R1238:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1239:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1301:Chd1l UTSW 3 97603648 splice site probably benign
R1366:Chd1l UTSW 3 97581149 missense probably damaging 0.99
R1444:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1445:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1500:Chd1l UTSW 3 97582805 missense probably benign 0.01
R1619:Chd1l UTSW 3 97582731 missense probably benign 0.01
R1640:Chd1l UTSW 3 97580991 missense probably benign 0.00
R1762:Chd1l UTSW 3 97588299 missense probably damaging 1.00
R2291:Chd1l UTSW 3 97591283 missense probably damaging 1.00
R2444:Chd1l UTSW 3 97590566 missense probably damaging 1.00
R4008:Chd1l UTSW 3 97570402 missense probably benign 0.01
R4011:Chd1l UTSW 3 97570402 missense probably benign 0.01
R4106:Chd1l UTSW 3 97597703 missense probably benign 0.09
R4857:Chd1l UTSW 3 97572659 missense probably benign 0.27
R5008:Chd1l UTSW 3 97583908 missense probably damaging 1.00
R5337:Chd1l UTSW 3 97562616 missense probably damaging 1.00
R5844:Chd1l UTSW 3 97572567 missense probably benign 0.04
R6283:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6298:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6309:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6311:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6321:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6327:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6364:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6366:Chd1l UTSW 3 97594160 missense probably benign 0.00
R6467:Chd1l UTSW 3 97563533 missense probably damaging 0.97
R6483:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6493:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6494:Chd1l UTSW 3 97587167 missense probably damaging 1.00
R6585:Chd1l UTSW 3 97597772 missense probably damaging 0.96
R6925:Chd1l UTSW 3 97582826 missense probably damaging 1.00
R7148:Chd1l UTSW 3 97591316 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAACGACTGATGAGGCGTGG -3'
(R):5'- GCACCTGAAAGGTTTTCCTTGGC -3'

Sequencing Primer
(F):5'- GTTTAAATCCAGGTTAGACAGCCC -3'
(R):5'- AGCATCCTTGTAGAAATGCCCTG -3'
Posted On2014-01-29