Incidental Mutation 'R1237:Amz1'
List |< first << previous [record 70 of 1308] next >> last >|
ID152456
Institutional Source Beutler Lab
Gene Symbol Amz1
Ensembl Gene ENSMUSG00000050022
Gene Namearchaelysin family metallopeptidase 1
Synonyms
MMRRC Submission 039304-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R1237 (G1)
Quality Score197
Status Validated
Chromosome5
Chromosomal Location140724127-140761439 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 140741284 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000113911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060918] [ENSMUST00000120630]
Predicted Effect probably damaging
Transcript: ENSMUST00000060918
AA Change: M1L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053110
Gene: ENSMUSG00000050022
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 225 239 N/A INTRINSIC
low complexity region 475 494 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120630
AA Change: M1L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113911
Gene: ENSMUSG00000050022
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 225 239 N/A INTRINSIC
low complexity region 475 494 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156006
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,948,357 T500A probably damaging Het
Angptl1 T A 1: 156,858,584 N413K probably damaging Het
Ankrd13b T C 11: 77,474,574 T70A probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Ccdc174 C T 6: 91,890,787 probably benign Het
Ccnc T A 4: 21,730,457 F31L probably benign Het
Celsr1 A C 15: 85,903,974 S2692R probably benign Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Ddhd1 A T 14: 45,601,650 D65E probably benign Het
Dync1h1 A G 12: 110,665,959 N4504S probably benign Het
Enthd1 A G 15: 80,534,598 S167P probably damaging Het
Fat1 A T 8: 45,044,279 Y4267F probably damaging Het
Hectd4 C T 5: 121,321,507 A813V possibly damaging Het
Ibtk T C 9: 85,720,748 S735G probably benign Het
Itga4 A G 2: 79,279,146 I230V probably null Het
Kcnh8 A T 17: 52,893,960 Q474L probably damaging Het
Kcnh8 G T 17: 52,893,961 Q474H probably damaging Het
Mib1 C T 18: 10,768,149 T466I probably damaging Het
Olfr101 T A 17: 37,300,265 R52S probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr167 A C 16: 19,515,625 Y4D probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Prdx6b A G 2: 80,293,176 I110V probably benign Het
Prf1 A C 10: 61,303,649 D462A probably benign Het
Rps6ka5 T C 12: 100,575,705 D391G possibly damaging Het
Scn7a A T 2: 66,680,295 N1254K probably damaging Het
Skor2 A T 18: 76,876,132 K924* probably null Het
Slc22a21 A G 11: 53,979,772 I29T probably benign Het
Tas2r140 T C 6: 133,055,208 T196A probably benign Het
Thrap3 A G 4: 126,180,069 S295P probably benign Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Ubtd2 C T 11: 32,516,125 R115W probably damaging Het
Unc93b1 A G 19: 3,935,228 E12G possibly damaging Het
Vgll3 T A 16: 65,839,573 Y203* probably null Het
Vmn1r212 G A 13: 22,883,468 Q232* probably null Het
Vmn2r107 T A 17: 20,356,685 L315* probably null Het
Vmn2r84 T A 10: 130,387,856 probably null Het
Washc5 A G 15: 59,338,908 probably benign Het
Other mutations in Amz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01808:Amz1 APN 5 140741279 utr 5 prime probably benign
IGL02340:Amz1 APN 5 140752259 missense probably damaging 1.00
IGL03389:Amz1 APN 5 140752027
PIT4131001:Amz1 UTSW 5 140749333 critical splice donor site probably null
R1173:Amz1 UTSW 5 140751936 critical splice acceptor site probably null
R1435:Amz1 UTSW 5 140748166 missense probably damaging 1.00
R1909:Amz1 UTSW 5 140752461 missense probably benign 0.30
R2019:Amz1 UTSW 5 140751964 missense probably benign 0.00
R4094:Amz1 UTSW 5 140752166 missense probably damaging 0.99
R4374:Amz1 UTSW 5 140752439 missense possibly damaging 0.83
R5121:Amz1 UTSW 5 140744164 missense probably benign 0.05
R5462:Amz1 UTSW 5 140748221 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGAATTAAGCCTCGTGGTCTCTC -3'
(R):5'- GCATGGAAGGTCTCGAAATCCTCAG -3'

Sequencing Primer
(F):5'- GTGGTCTCTCAGTCCAGC -3'
(R):5'- GCTCAGGAGCCAGTCATAG -3'
Posted On2014-01-29