Incidental Mutation 'R1237:Prf1'
ID152463
Institutional Source Beutler Lab
Gene Symbol Prf1
Ensembl Gene ENSMUSG00000037202
Gene Nameperforin 1 (pore forming protein)
SynonymsPfn, Prf-1, perforin, Pfp
MMRRC Submission 039304-MU
Accession Numbers

Ncbi RefSeq: NM_011073; MGI: 97551

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1237 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location61297833-61304680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 61303649 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 462 (D462A)
Ref Sequence ENSEMBL: ENSMUSP00000151354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035419] [ENSMUST00000219375]
Predicted Effect probably benign
Transcript: ENSMUST00000035419
AA Change: D462A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000041483
Gene: ENSMUSG00000037202
AA Change: D462A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MACPF 165 368 1.84e-80 SMART
C2 415 516 1.59e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219375
AA Change: D462A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.1268 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has structural and functional similarities to complement component 9 (C9). Like C9, this protein creates transmembrane tubules and is capable of lysing non-specifically a variety of target cells. This protein is one of the main cytolytic proteins of cytolytic granules, and it is known to be a key effector molecule for T-cell- and natural killer-cell-mediated cytolysis. Defects in this gene cause familial hemophagocytic lymphohistiocytosis type 2 (HPLH2), a rare and lethal autosomal recessive disorder of early childhood. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit increased susceptibility to viral infection and defective cytotoxic T cell cytolysis and NK cell cytolysis. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(7)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,948,357 T500A probably damaging Het
Amz1 A T 5: 140,741,284 M1L probably damaging Het
Angptl1 T A 1: 156,858,584 N413K probably damaging Het
Ankrd13b T C 11: 77,474,574 T70A probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Ccdc174 C T 6: 91,890,787 probably benign Het
Ccnc T A 4: 21,730,457 F31L probably benign Het
Celsr1 A C 15: 85,903,974 S2692R probably benign Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Ddhd1 A T 14: 45,601,650 D65E probably benign Het
Dync1h1 A G 12: 110,665,959 N4504S probably benign Het
Enthd1 A G 15: 80,534,598 S167P probably damaging Het
Fat1 A T 8: 45,044,279 Y4267F probably damaging Het
Hectd4 C T 5: 121,321,507 A813V possibly damaging Het
Ibtk T C 9: 85,720,748 S735G probably benign Het
Itga4 A G 2: 79,279,146 I230V probably null Het
Kcnh8 A T 17: 52,893,960 Q474L probably damaging Het
Kcnh8 G T 17: 52,893,961 Q474H probably damaging Het
Mib1 C T 18: 10,768,149 T466I probably damaging Het
Olfr101 T A 17: 37,300,265 R52S probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr167 A C 16: 19,515,625 Y4D probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Prdx6b A G 2: 80,293,176 I110V probably benign Het
Rps6ka5 T C 12: 100,575,705 D391G possibly damaging Het
Scn7a A T 2: 66,680,295 N1254K probably damaging Het
Skor2 A T 18: 76,876,132 K924* probably null Het
Slc22a21 A G 11: 53,979,772 I29T probably benign Het
Tas2r140 T C 6: 133,055,208 T196A probably benign Het
Thrap3 A G 4: 126,180,069 S295P probably benign Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Ubtd2 C T 11: 32,516,125 R115W probably damaging Het
Unc93b1 A G 19: 3,935,228 E12G possibly damaging Het
Vgll3 T A 16: 65,839,573 Y203* probably null Het
Vmn1r212 G A 13: 22,883,468 Q232* probably null Het
Vmn2r107 T A 17: 20,356,685 L315* probably null Het
Vmn2r84 T A 10: 130,387,856 probably null Het
Washc5 A G 15: 59,338,908 probably benign Het
Other mutations in Prf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02970:Prf1 APN 10 61300178 missense probably benign
prime UTSW 10 61303722 nonsense probably null
R0526:Prf1 UTSW 10 61300254 missense probably benign 0.01
R0594:Prf1 UTSW 10 61303722 nonsense probably null
R1508:Prf1 UTSW 10 61303550 missense probably damaging 1.00
R1553:Prf1 UTSW 10 61303169 missense probably damaging 1.00
R1665:Prf1 UTSW 10 61302887 missense probably benign 0.29
R1716:Prf1 UTSW 10 61300452 missense probably benign 0.01
R1817:Prf1 UTSW 10 61302983 missense probably damaging 1.00
R1818:Prf1 UTSW 10 61302983 missense probably damaging 1.00
R2014:Prf1 UTSW 10 61303895 missense probably benign 0.41
R2307:Prf1 UTSW 10 61303163 missense possibly damaging 0.80
R2901:Prf1 UTSW 10 61300319 missense probably damaging 0.96
R2902:Prf1 UTSW 10 61300319 missense probably damaging 0.96
R4724:Prf1 UTSW 10 61303708 missense probably damaging 1.00
R4781:Prf1 UTSW 10 61300424 missense probably damaging 1.00
R5327:Prf1 UTSW 10 61300258 missense probably benign 0.00
R5850:Prf1 UTSW 10 61300193 missense probably benign 0.00
R5999:Prf1 UTSW 10 61303028 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCCTGCACACATTACTGGAAG -3'
(R):5'- CGTGGTTTAGCTCACATGTCACCTC -3'

Sequencing Primer
(F):5'- AGCCATGATTCATGCCAGTG -3'
(R):5'- TGTCACCTCATGGAAACCAGAG -3'
Posted On2014-01-29