Incidental Mutation 'R1237:Olfr1368'
ID152470
Institutional Source Beutler Lab
Gene Symbol Olfr1368
Ensembl Gene ENSMUSG00000045474
Gene Nameolfactory receptor 1368
SynonymsMOR256-15, GA_x6K02T2QHY8-12104556-12105500
MMRRC Submission 039304-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R1237 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location21141882-21145867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21142167 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 297 (V297I)
Ref Sequence ENSEMBL: ENSMUSP00000149549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055298] [ENSMUST00000216039]
Predicted Effect probably benign
Transcript: ENSMUST00000055298
AA Change: V297I

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000050942
Gene: ENSMUSG00000045474
AA Change: V297I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.8e-49 PFAM
Pfam:7tm_1 41 290 1.6e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206267
Predicted Effect probably benign
Transcript: ENSMUST00000216039
AA Change: V297I

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.1264 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,948,357 T500A probably damaging Het
Amz1 A T 5: 140,741,284 M1L probably damaging Het
Angptl1 T A 1: 156,858,584 N413K probably damaging Het
Ankrd13b T C 11: 77,474,574 T70A probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Ccdc174 C T 6: 91,890,787 probably benign Het
Ccnc T A 4: 21,730,457 F31L probably benign Het
Celsr1 A C 15: 85,903,974 S2692R probably benign Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Ddhd1 A T 14: 45,601,650 D65E probably benign Het
Dync1h1 A G 12: 110,665,959 N4504S probably benign Het
Enthd1 A G 15: 80,534,598 S167P probably damaging Het
Fat1 A T 8: 45,044,279 Y4267F probably damaging Het
Hectd4 C T 5: 121,321,507 A813V possibly damaging Het
Ibtk T C 9: 85,720,748 S735G probably benign Het
Itga4 A G 2: 79,279,146 I230V probably null Het
Kcnh8 A T 17: 52,893,960 Q474L probably damaging Het
Kcnh8 G T 17: 52,893,961 Q474H probably damaging Het
Mib1 C T 18: 10,768,149 T466I probably damaging Het
Olfr101 T A 17: 37,300,265 R52S probably benign Het
Olfr167 A C 16: 19,515,625 Y4D probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Prdx6b A G 2: 80,293,176 I110V probably benign Het
Prf1 A C 10: 61,303,649 D462A probably benign Het
Rps6ka5 T C 12: 100,575,705 D391G possibly damaging Het
Scn7a A T 2: 66,680,295 N1254K probably damaging Het
Skor2 A T 18: 76,876,132 K924* probably null Het
Slc22a21 A G 11: 53,979,772 I29T probably benign Het
Tas2r140 T C 6: 133,055,208 T196A probably benign Het
Thrap3 A G 4: 126,180,069 S295P probably benign Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Ubtd2 C T 11: 32,516,125 R115W probably damaging Het
Unc93b1 A G 19: 3,935,228 E12G possibly damaging Het
Vgll3 T A 16: 65,839,573 Y203* probably null Het
Vmn1r212 G A 13: 22,883,468 Q232* probably null Het
Vmn2r107 T A 17: 20,356,685 L315* probably null Het
Vmn2r84 T A 10: 130,387,856 probably null Het
Washc5 A G 15: 59,338,908 probably benign Het
Other mutations in Olfr1368
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03354:Olfr1368 APN 13 21142484 missense probably damaging 1.00
IGL03385:Olfr1368 APN 13 21142487 missense probably benign 0.01
R0137:Olfr1368 UTSW 13 21142166 missense possibly damaging 0.86
R1168:Olfr1368 UTSW 13 21142617 missense probably benign 0.04
R1212:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1214:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1238:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1239:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1280:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1309:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1436:Olfr1368 UTSW 13 21142992 missense probably benign 0.01
R1443:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1444:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1602:Olfr1368 UTSW 13 21142650 missense probably damaging 0.99
R1627:Olfr1368 UTSW 13 21142955 missense probably damaging 0.99
R1649:Olfr1368 UTSW 13 21142742 missense probably damaging 1.00
R1781:Olfr1368 UTSW 13 21142764 missense probably benign 0.08
R1858:Olfr1368 UTSW 13 21142394 missense probably damaging 1.00
R2520:Olfr1368 UTSW 13 21142576 nonsense probably null
R4873:Olfr1368 UTSW 13 21142280 missense probably damaging 1.00
R4875:Olfr1368 UTSW 13 21142280 missense probably damaging 1.00
R5009:Olfr1368 UTSW 13 21142265 missense probably benign 0.01
R6222:Olfr1368 UTSW 13 21142877 missense probably damaging 1.00
R7031:Olfr1368 UTSW 13 21143000 missense probably benign
R7126:Olfr1368 UTSW 13 21142718 missense not run
Predicted Primers PCR Primer
(F):5'- ATGCCAGGGAAATGGTCCTGAATG -3'
(R):5'- ACCCTGTGCTTTGCCAGAAGATG -3'

Sequencing Primer
(F):5'- ATGGTCCTGAATGAACTGATCTGC -3'
(R):5'- GCAGTTATCACTCAAGCTGTG -3'
Posted On2014-01-29