Incidental Mutation 'R1237:Ddhd1'
ID152472
Institutional Source Beutler Lab
Gene Symbol Ddhd1
Ensembl Gene ENSMUSG00000037697
Gene NameDDHD domain containing 1
Synonyms9630061G18Rik, 4921528E07Rik
MMRRC Submission 039304-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R1237 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location45588467-45658143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45601650 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 65 (D65E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051310] [ENSMUST00000087320] [ENSMUST00000111828] [ENSMUST00000149286]
Predicted Effect probably benign
Transcript: ENSMUST00000051310
AA Change: D768E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050088
Gene: ENSMUSG00000037697
AA Change: D768E

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 450 573 6e-67 BLAST
DDHD 595 842 1.49e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087320
AA Change: D802E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084577
Gene: ENSMUSG00000037697
AA Change: D802E

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 484 607 1e-66 BLAST
DDHD 629 904 3.75e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111828
AA Change: D768E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107459
Gene: ENSMUSG00000037697
AA Change: D768E

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Blast:DDHD 450 573 8e-67 BLAST
DDHD 595 870 3.75e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129599
Predicted Effect probably benign
Transcript: ENSMUST00000141487
SMART Domains Protein: ENSMUSP00000133358
Gene: ENSMUSG00000037697

DomainStartEndE-ValueType
Blast:DDHD 111 149 1e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149286
SMART Domains Protein: ENSMUSP00000118848
Gene: ENSMUSG00000037697

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 95 111 N/A INTRINSIC
low complexity region 118 141 N/A INTRINSIC
low complexity region 183 201 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152110
Predicted Effect probably benign
Transcript: ENSMUST00000156758
AA Change: D65E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000121837
Gene: ENSMUSG00000037697
AA Change: D65E

DomainStartEndE-ValueType
DDHD 1 168 3.8e-11 SMART
Meta Mutation Damage Score 0.1532 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the intracellular phospholipase A1 gene family. The protein encoded by this gene preferentially hydrolyzes phosphatidic acid. It is a cytosolic protein with some mitochondrial localization, and is thought to be involved in the regulation of mitochondrial dynamics. Overexpression of this gene causes fragmentation of the tubular structures in mitochondria, while depletion of the gene results in mitochondrial tubule elongation. Deletion of this gene in male mice caused fertility defects, resulting from disruption in the organization of the mitochondria during spermiogenesis. In humans, mutations in this gene have been associated with hereditary spastic paraplegia (HSP), also known as Strumpell-Lorrain disease, or, familial spastic paraparesis (FSP). This inherited disorder is characterized by progressive weakness and spasticity of the legs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele show reduced testis weight, oligozoospermia, teratozoospermia, and male subfertility. Sperm defects include a disorganized mitochondrial structure, an abnormal gap between the middle and principal pieces, and hairpin flagellum leading to impaired sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,948,357 T500A probably damaging Het
Amz1 A T 5: 140,741,284 M1L probably damaging Het
Angptl1 T A 1: 156,858,584 N413K probably damaging Het
Ankrd13b T C 11: 77,474,574 T70A probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Ccdc174 C T 6: 91,890,787 probably benign Het
Ccnc T A 4: 21,730,457 F31L probably benign Het
Celsr1 A C 15: 85,903,974 S2692R probably benign Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Dync1h1 A G 12: 110,665,959 N4504S probably benign Het
Enthd1 A G 15: 80,534,598 S167P probably damaging Het
Fat1 A T 8: 45,044,279 Y4267F probably damaging Het
Hectd4 C T 5: 121,321,507 A813V possibly damaging Het
Ibtk T C 9: 85,720,748 S735G probably benign Het
Itga4 A G 2: 79,279,146 I230V probably null Het
Kcnh8 A T 17: 52,893,960 Q474L probably damaging Het
Kcnh8 G T 17: 52,893,961 Q474H probably damaging Het
Mib1 C T 18: 10,768,149 T466I probably damaging Het
Olfr101 T A 17: 37,300,265 R52S probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr167 A C 16: 19,515,625 Y4D probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Prdx6b A G 2: 80,293,176 I110V probably benign Het
Prf1 A C 10: 61,303,649 D462A probably benign Het
Rps6ka5 T C 12: 100,575,705 D391G possibly damaging Het
Scn7a A T 2: 66,680,295 N1254K probably damaging Het
Skor2 A T 18: 76,876,132 K924* probably null Het
Slc22a21 A G 11: 53,979,772 I29T probably benign Het
Tas2r140 T C 6: 133,055,208 T196A probably benign Het
Thrap3 A G 4: 126,180,069 S295P probably benign Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Ubtd2 C T 11: 32,516,125 R115W probably damaging Het
Unc93b1 A G 19: 3,935,228 E12G possibly damaging Het
Vgll3 T A 16: 65,839,573 Y203* probably null Het
Vmn1r212 G A 13: 22,883,468 Q232* probably null Het
Vmn2r107 T A 17: 20,356,685 L315* probably null Het
Vmn2r84 T A 10: 130,387,856 probably null Het
Washc5 A G 15: 59,338,908 probably benign Het
Other mutations in Ddhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Ddhd1 APN 14 45616551 missense probably damaging 1.00
IGL01635:Ddhd1 APN 14 45629580 missense probably null 0.98
IGL02176:Ddhd1 APN 14 45616600 missense probably damaging 1.00
IGL02698:Ddhd1 APN 14 45605206 unclassified probably benign
IGL03052:Ddhd1 UTSW 14 45620783 missense probably damaging 1.00
R0037:Ddhd1 UTSW 14 45610510 missense probably damaging 1.00
R0105:Ddhd1 UTSW 14 45610690 missense probably benign 0.37
R0165:Ddhd1 UTSW 14 45595592 missense probably damaging 1.00
R1401:Ddhd1 UTSW 14 45605051 critical splice donor site probably null
R1574:Ddhd1 UTSW 14 45595547 missense probably damaging 1.00
R1574:Ddhd1 UTSW 14 45595547 missense probably damaging 1.00
R1582:Ddhd1 UTSW 14 45605109 missense probably damaging 0.98
R2070:Ddhd1 UTSW 14 45610624 missense probably damaging 1.00
R2307:Ddhd1 UTSW 14 45608990 missense probably damaging 1.00
R2417:Ddhd1 UTSW 14 45657272 missense probably damaging 1.00
R3756:Ddhd1 UTSW 14 45610573 missense probably benign 0.00
R3756:Ddhd1 UTSW 14 45657263 missense probably damaging 1.00
R4541:Ddhd1 UTSW 14 45622856 nonsense probably null
R4737:Ddhd1 UTSW 14 45628821 intron probably benign
R5105:Ddhd1 UTSW 14 45657407 missense probably benign 0.00
R5810:Ddhd1 UTSW 14 45602707 missense probably damaging 1.00
R5898:Ddhd1 UTSW 14 45602668 missense probably damaging 1.00
R6217:Ddhd1 UTSW 14 45619514 intron probably null
R6218:Ddhd1 UTSW 14 45614176 missense probably damaging 1.00
R6671:Ddhd1 UTSW 14 45657232 frame shift probably null
R6787:Ddhd1 UTSW 14 45657519 missense probably benign 0.01
R7049:Ddhd1 UTSW 14 45602681 missense probably damaging 1.00
R7150:Ddhd1 UTSW 14 45657806 missense not run
Predicted Primers PCR Primer
(F):5'- CAAGAGAATGCCTCAGCCTTGGAG -3'
(R):5'- TTAGGTCCCCACCCTGAGAAAGTC -3'

Sequencing Primer
(F):5'- GTACAAGCTAGGGTTGCCTAC -3'
(R):5'- TGAGAAAGTCCCTCAGTCAGTC -3'
Posted On2014-01-29