Incidental Mutation 'R1237:Enthd1'
ID152474
Institutional Source Beutler Lab
Gene Symbol Enthd1
Ensembl Gene ENSMUSG00000050439
Gene NameENTH domain containing 1
SynonymsLOC383075
MMRRC Submission 039304-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R1237 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location80452240-80565156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80534598 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 167 (S167P)
Ref Sequence ENSEMBL: ENSMUSP00000155166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096347] [ENSMUST00000229110]
Predicted Effect probably damaging
Transcript: ENSMUST00000096347
AA Change: S167P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094072
Gene: ENSMUSG00000050439
AA Change: S167P

DomainStartEndE-ValueType
ENTH 15 141 1.53e-50 SMART
low complexity region 419 432 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000229110
AA Change: S167P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,948,357 T500A probably damaging Het
Amz1 A T 5: 140,741,284 M1L probably damaging Het
Angptl1 T A 1: 156,858,584 N413K probably damaging Het
Ankrd13b T C 11: 77,474,574 T70A probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Ccdc174 C T 6: 91,890,787 probably benign Het
Ccnc T A 4: 21,730,457 F31L probably benign Het
Celsr1 A C 15: 85,903,974 S2692R probably benign Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Ddhd1 A T 14: 45,601,650 D65E probably benign Het
Dync1h1 A G 12: 110,665,959 N4504S probably benign Het
Fat1 A T 8: 45,044,279 Y4267F probably damaging Het
Hectd4 C T 5: 121,321,507 A813V possibly damaging Het
Ibtk T C 9: 85,720,748 S735G probably benign Het
Itga4 A G 2: 79,279,146 I230V probably null Het
Kcnh8 A T 17: 52,893,960 Q474L probably damaging Het
Kcnh8 G T 17: 52,893,961 Q474H probably damaging Het
Mib1 C T 18: 10,768,149 T466I probably damaging Het
Olfr101 T A 17: 37,300,265 R52S probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr167 A C 16: 19,515,625 Y4D probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Prdx6b A G 2: 80,293,176 I110V probably benign Het
Prf1 A C 10: 61,303,649 D462A probably benign Het
Rps6ka5 T C 12: 100,575,705 D391G possibly damaging Het
Scn7a A T 2: 66,680,295 N1254K probably damaging Het
Skor2 A T 18: 76,876,132 K924* probably null Het
Slc22a21 A G 11: 53,979,772 I29T probably benign Het
Tas2r140 T C 6: 133,055,208 T196A probably benign Het
Thrap3 A G 4: 126,180,069 S295P probably benign Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Ubtd2 C T 11: 32,516,125 R115W probably damaging Het
Unc93b1 A G 19: 3,935,228 E12G possibly damaging Het
Vgll3 T A 16: 65,839,573 Y203* probably null Het
Vmn1r212 G A 13: 22,883,468 Q232* probably null Het
Vmn2r107 T A 17: 20,356,685 L315* probably null Het
Vmn2r84 T A 10: 130,387,856 probably null Het
Washc5 A G 15: 59,338,908 probably benign Het
Other mutations in Enthd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Enthd1 APN 15 80452451 missense probably damaging 0.98
IGL02127:Enthd1 APN 15 80452742 missense probably damaging 1.00
R0190:Enthd1 UTSW 15 80534494 splice site probably null
R1616:Enthd1 UTSW 15 80452385 missense probably damaging 1.00
R1697:Enthd1 UTSW 15 80452923 missense probably damaging 1.00
R1826:Enthd1 UTSW 15 80474281 missense probably damaging 0.99
R2037:Enthd1 UTSW 15 80560349 missense possibly damaging 0.86
R3420:Enthd1 UTSW 15 80560024 missense probably damaging 1.00
R3814:Enthd1 UTSW 15 80452682 missense probably benign 0.11
R4049:Enthd1 UTSW 15 80560039 missense probably damaging 0.99
R4403:Enthd1 UTSW 15 80452824 missense probably benign 0.00
R4720:Enthd1 UTSW 15 80560309 missense probably damaging 1.00
R6062:Enthd1 UTSW 15 80452715 missense probably damaging 0.96
R6143:Enthd1 UTSW 15 80509286 missense possibly damaging 0.96
R6984:Enthd1 UTSW 15 80560108 missense probably damaging 1.00
R7062:Enthd1 UTSW 15 80452544 missense probably damaging 1.00
R7105:Enthd1 UTSW 15 80509209 missense not run
Predicted Primers PCR Primer
(F):5'- TCCAGAGTCAAAGTTGCAGGCAAAG -3'
(R):5'- TTCAGGTCACTACATCCGGGAGAG -3'

Sequencing Primer
(F):5'- GACAGTCCTGCTGATACTGAG -3'
(R):5'- GGTCGAAGCAGGTCATAACTC -3'
Posted On2014-01-29