Incidental Mutation 'R1237:Vgll3'
ID152478
Institutional Source Beutler Lab
Gene Symbol Vgll3
Ensembl Gene ENSMUSG00000091243
Gene Namevestigial like family member 3
Synonyms1700110N18Rik, Vito-2
MMRRC Submission 039304-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R1237 (G1)
Quality Score222
Status Validated
Chromosome16
Chromosomal Location65815257-65866368 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 65839573 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 203 (Y203*)
Ref Sequence ENSEMBL: ENSMUSP00000153843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168064] [ENSMUST00000227997]
Predicted Effect probably null
Transcript: ENSMUST00000168064
AA Change: Y258*
SMART Domains Protein: ENSMUSP00000131500
Gene: ENSMUSG00000091243
AA Change: Y258*

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
TDU 101 116 9.18e-4 SMART
low complexity region 231 247 N/A INTRINSIC
low complexity region 279 296 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000227997
AA Change: Y203*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228708
Meta Mutation Damage Score 0.662 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,948,357 T500A probably damaging Het
Amz1 A T 5: 140,741,284 M1L probably damaging Het
Angptl1 T A 1: 156,858,584 N413K probably damaging Het
Ankrd13b T C 11: 77,474,574 T70A probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Ccdc174 C T 6: 91,890,787 probably benign Het
Ccnc T A 4: 21,730,457 F31L probably benign Het
Celsr1 A C 15: 85,903,974 S2692R probably benign Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Ddhd1 A T 14: 45,601,650 D65E probably benign Het
Dync1h1 A G 12: 110,665,959 N4504S probably benign Het
Enthd1 A G 15: 80,534,598 S167P probably damaging Het
Fat1 A T 8: 45,044,279 Y4267F probably damaging Het
Hectd4 C T 5: 121,321,507 A813V possibly damaging Het
Ibtk T C 9: 85,720,748 S735G probably benign Het
Itga4 A G 2: 79,279,146 I230V probably null Het
Kcnh8 A T 17: 52,893,960 Q474L probably damaging Het
Kcnh8 G T 17: 52,893,961 Q474H probably damaging Het
Mib1 C T 18: 10,768,149 T466I probably damaging Het
Olfr101 T A 17: 37,300,265 R52S probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr167 A C 16: 19,515,625 Y4D probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Prdx6b A G 2: 80,293,176 I110V probably benign Het
Prf1 A C 10: 61,303,649 D462A probably benign Het
Rps6ka5 T C 12: 100,575,705 D391G possibly damaging Het
Scn7a A T 2: 66,680,295 N1254K probably damaging Het
Skor2 A T 18: 76,876,132 K924* probably null Het
Slc22a21 A G 11: 53,979,772 I29T probably benign Het
Tas2r140 T C 6: 133,055,208 T196A probably benign Het
Thrap3 A G 4: 126,180,069 S295P probably benign Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Ubtd2 C T 11: 32,516,125 R115W probably damaging Het
Unc93b1 A G 19: 3,935,228 E12G possibly damaging Het
Vmn1r212 G A 13: 22,883,468 Q232* probably null Het
Vmn2r107 T A 17: 20,356,685 L315* probably null Het
Vmn2r84 T A 10: 130,387,856 probably null Het
Washc5 A G 15: 59,338,908 probably benign Het
Other mutations in Vgll3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02392:Vgll3 APN 16 65815670 missense probably damaging 1.00
R0786:Vgll3 UTSW 16 65860682 missense probably benign
R1761:Vgll3 UTSW 16 65839728 missense probably damaging 0.97
R4956:Vgll3 UTSW 16 65827934 missense possibly damaging 0.95
R4978:Vgll3 UTSW 16 65815686 nonsense probably null
R5969:Vgll3 UTSW 16 65839563 missense probably damaging 1.00
R6031:Vgll3 UTSW 16 65839481 missense probably damaging 0.98
R6031:Vgll3 UTSW 16 65839481 missense probably damaging 0.98
R6150:Vgll3 UTSW 16 65828178 critical splice donor site probably null
R6371:Vgll3 UTSW 16 65839245 missense probably damaging 0.99
R6431:Vgll3 UTSW 16 65815754 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACGGCACCTTTACTACAGCAGATCC -3'
(R):5'- TGTATCGAAGCCCACACTTGGCAC -3'

Sequencing Primer
(F):5'- ACATGGCCTGCATCAGACTG -3'
(R):5'- ACTTGGCACGATGTCCACTG -3'
Posted On2014-01-29