Incidental Mutation 'R1237:Mib1'
ID152483
Institutional Source Beutler Lab
Gene Symbol Mib1
Ensembl Gene ENSMUSG00000024294
Gene Namemindbomb E3 ubiquitin protein ligase 1
SynonymsMib, mind bomb-1, skeletrophin, E430019M12Rik
MMRRC Submission 039304-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1237 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location10725548-10818704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 10768149 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 466 (T466I)
Ref Sequence ENSEMBL: ENSMUSP00000131712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052838] [ENSMUST00000165555]
Predicted Effect probably damaging
Transcript: ENSMUST00000052838
AA Change: T466I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054428
Gene: ENSMUSG00000024294
AA Change: T466I

DomainStartEndE-ValueType
Pfam:MIB_HERC2 15 72 5.6e-21 PFAM
ZnF_ZZ 79 124 1.01e-10 SMART
Pfam:MIB_HERC2 154 219 4.9e-31 PFAM
ANK 430 460 1.63e3 SMART
ANK 463 492 2.1e-3 SMART
ANK 496 525 2.47e2 SMART
ANK 529 558 6.02e-4 SMART
ANK 562 591 1.14e-4 SMART
ANK 595 626 6.26e-2 SMART
ANK 631 661 1.24e-5 SMART
ANK 665 694 9.27e-5 SMART
ANK 698 729 1.04e2 SMART
RING 819 853 1.8e-1 SMART
RING 866 900 1.9e-1 SMART
RING 963 995 4.58e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000124288
AA Change: T100I
SMART Domains Protein: ENSMUSP00000114289
Gene: ENSMUSG00000024294
AA Change: T100I

DomainStartEndE-ValueType
ANK 65 95 1.63e3 SMART
ANK 98 127 2.1e-3 SMART
ANK 131 160 2.47e2 SMART
ANK 164 193 6.02e-4 SMART
ANK 197 226 1.14e-4 SMART
ANK 230 261 6.26e-2 SMART
ANK 266 296 1.24e-5 SMART
ANK 300 329 9.27e-5 SMART
ANK 333 364 1.04e2 SMART
RING 454 488 1.8e-1 SMART
RING 501 535 1.9e-1 SMART
RING 598 630 4.58e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165555
AA Change: T466I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131712
Gene: ENSMUSG00000024294
AA Change: T466I

DomainStartEndE-ValueType
Pfam:MIB_HERC2 15 74 5.7e-25 PFAM
ZnF_ZZ 79 124 1.01e-10 SMART
Pfam:MIB_HERC2 154 221 5.5e-31 PFAM
ANK 430 460 1.63e3 SMART
ANK 463 492 2.1e-3 SMART
ANK 496 525 2.47e2 SMART
ANK 529 558 6.02e-4 SMART
ANK 562 591 1.14e-4 SMART
ANK 595 626 6.26e-2 SMART
ANK 631 661 1.24e-5 SMART
ANK 665 694 9.27e-5 SMART
ANK 698 729 1.04e2 SMART
RING 819 853 1.8e-1 SMART
RING 866 900 1.9e-1 SMART
RING 963 995 4.58e-4 SMART
Meta Mutation Damage Score 0.462 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin repeats and RING finger domains that functions as an E3 ubiquitin ligase. The encoded protein positively regulates Notch signaling by ubiquitinating the Notch receptors, thereby facilitating their endocytosis. This protein may also promote the ubiquitination and degradation of death-associated protein kinase 1 (DAPK1). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, failure of heart looping, impaired angiogenesis and arterial specification, premature neuronal precursor differentiation, posterior truncation, and abnormal somitogenesis with loss ofposterior markers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,948,357 T500A probably damaging Het
Amz1 A T 5: 140,741,284 M1L probably damaging Het
Angptl1 T A 1: 156,858,584 N413K probably damaging Het
Ankrd13b T C 11: 77,474,574 T70A probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Ccdc174 C T 6: 91,890,787 probably benign Het
Ccnc T A 4: 21,730,457 F31L probably benign Het
Celsr1 A C 15: 85,903,974 S2692R probably benign Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Ddhd1 A T 14: 45,601,650 D65E probably benign Het
Dync1h1 A G 12: 110,665,959 N4504S probably benign Het
Enthd1 A G 15: 80,534,598 S167P probably damaging Het
Fat1 A T 8: 45,044,279 Y4267F probably damaging Het
Hectd4 C T 5: 121,321,507 A813V possibly damaging Het
Ibtk T C 9: 85,720,748 S735G probably benign Het
Itga4 A G 2: 79,279,146 I230V probably null Het
Kcnh8 A T 17: 52,893,960 Q474L probably damaging Het
Kcnh8 G T 17: 52,893,961 Q474H probably damaging Het
Olfr101 T A 17: 37,300,265 R52S probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr167 A C 16: 19,515,625 Y4D probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Prdx6b A G 2: 80,293,176 I110V probably benign Het
Prf1 A C 10: 61,303,649 D462A probably benign Het
Rps6ka5 T C 12: 100,575,705 D391G possibly damaging Het
Scn7a A T 2: 66,680,295 N1254K probably damaging Het
Skor2 A T 18: 76,876,132 K924* probably null Het
Slc22a21 A G 11: 53,979,772 I29T probably benign Het
Tas2r140 T C 6: 133,055,208 T196A probably benign Het
Thrap3 A G 4: 126,180,069 S295P probably benign Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Ubtd2 C T 11: 32,516,125 R115W probably damaging Het
Unc93b1 A G 19: 3,935,228 E12G possibly damaging Het
Vgll3 T A 16: 65,839,573 Y203* probably null Het
Vmn1r212 G A 13: 22,883,468 Q232* probably null Het
Vmn2r107 T A 17: 20,356,685 L315* probably null Het
Vmn2r84 T A 10: 130,387,856 probably null Het
Washc5 A G 15: 59,338,908 probably benign Het
Other mutations in Mib1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Mib1 APN 18 10798490 missense probably benign 0.02
IGL02300:Mib1 APN 18 10741016 missense probably damaging 1.00
IGL02701:Mib1 APN 18 10747357 missense probably damaging 0.98
IGL02731:Mib1 APN 18 10800115 missense possibly damaging 0.81
IGL03002:Mib1 APN 18 10798356 missense possibly damaging 0.87
IGL03083:Mib1 APN 18 10752029 critical splice donor site probably null
R0496:Mib1 UTSW 18 10804773 missense probably benign
R1015:Mib1 UTSW 18 10726409 missense probably damaging 1.00
R1557:Mib1 UTSW 18 10798474 missense probably damaging 1.00
R1918:Mib1 UTSW 18 10740972 splice site probably null
R1952:Mib1 UTSW 18 10812077 missense possibly damaging 0.94
R1982:Mib1 UTSW 18 10812064 missense probably damaging 1.00
R2009:Mib1 UTSW 18 10812118 missense probably damaging 1.00
R2372:Mib1 UTSW 18 10812045 missense probably damaging 1.00
R2422:Mib1 UTSW 18 10751906 missense probably damaging 1.00
R2922:Mib1 UTSW 18 10760831 nonsense probably null
R2923:Mib1 UTSW 18 10760831 nonsense probably null
R2938:Mib1 UTSW 18 10752033 splice site probably benign
R3814:Mib1 UTSW 18 10763281 missense probably benign 0.09
R3858:Mib1 UTSW 18 10798409 missense possibly damaging 0.56
R4356:Mib1 UTSW 18 10751844 missense probably benign 0.03
R4357:Mib1 UTSW 18 10751844 missense probably benign 0.03
R4358:Mib1 UTSW 18 10751844 missense probably benign 0.03
R4406:Mib1 UTSW 18 10763289 missense probably damaging 1.00
R4497:Mib1 UTSW 18 10811985 missense possibly damaging 0.75
R4593:Mib1 UTSW 18 10768191 missense possibly damaging 0.89
R4623:Mib1 UTSW 18 10808086 missense probably benign 0.02
R5068:Mib1 UTSW 18 10793002 missense probably damaging 0.99
R5069:Mib1 UTSW 18 10793002 missense probably damaging 0.99
R5070:Mib1 UTSW 18 10793002 missense probably damaging 0.99
R5258:Mib1 UTSW 18 10795856 splice site probably null
R5322:Mib1 UTSW 18 10792975 missense probably damaging 1.00
R5589:Mib1 UTSW 18 10794488 missense probably benign 0.00
R5622:Mib1 UTSW 18 10794503 missense possibly damaging 0.90
R6401:Mib1 UTSW 18 10795802 missense probably benign
R6928:Mib1 UTSW 18 10802282 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGCAGAGTAAGAACTACGGCTTTTGTC -3'
(R):5'- CCCAGCCAATGTCAGTATTTATTGCCC -3'

Sequencing Primer
(F):5'- TAAGAACTACGGCTTTTGTCTCTCG -3'
(R):5'- GCTACGTCTGAAATATTGAGGAGTC -3'
Posted On2014-01-29