Incidental Mutation 'R1238:Olfr50'
ID152486
Institutional Source Beutler Lab
Gene Symbol Olfr50
Ensembl Gene ENSMUSG00000111021
Gene Nameolfactory receptor 50
SynonymsGA_x6K02T2NLDC-33487752-33488690, ID3, MOR136-6
MMRRC Submission 039305-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R1238 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36790538-36797392 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36793589 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 118 (M118L)
Ref Sequence ENSEMBL: ENSMUSP00000149484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072114] [ENSMUST00000112950] [ENSMUST00000213498] [ENSMUST00000214909] [ENSMUST00000215199] [ENSMUST00000216753] [ENSMUST00000217041]
Predicted Effect probably damaging
Transcript: ENSMUST00000072114
AA Change: M118L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071985
Gene: ENSMUSG00000068950
AA Change: M118L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.3e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.8e-8 PFAM
Pfam:7tm_1 41 290 1.1e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112950
AA Change: M118L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108572
Gene: ENSMUSG00000111021
AA Change: M118L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 36 306 3e-6 PFAM
Pfam:7tm_1 42 291 3.5e-34 PFAM
Pfam:7tm_4 140 284 3.9e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213498
Predicted Effect probably benign
Transcript: ENSMUST00000214909
Predicted Effect probably benign
Transcript: ENSMUST00000215199
Predicted Effect probably damaging
Transcript: ENSMUST00000216753
AA Change: M118L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217041
AA Change: M118L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.372 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 G A 14: 118,597,639 probably benign Het
BC051665 T A 13: 60,784,637 N78I probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cep290 A C 10: 100,517,863 Q819H probably damaging Het
Cep70 T C 9: 99,254,265 I7T probably benign Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Cit T A 5: 115,851,221 F56I probably benign Het
Colec10 T C 15: 54,462,439 F222L possibly damaging Het
Crocc G A 4: 141,035,364 A769V probably benign Het
Ctcf T C 8: 105,671,277 probably benign Het
Ect2l T C 10: 18,143,104 R607G possibly damaging Het
Efcab6 T G 15: 83,933,137 E745A probably benign Het
Eif1ad T G 19: 5,370,083 *171G probably null Het
Gm4759 A G 7: 106,423,057 V246A probably damaging Het
H2-D1 A G 17: 35,263,932 D146G probably damaging Het
Iqub C T 6: 24,505,885 R8H probably benign Het
Itih4 A T 14: 30,887,949 I79F probably damaging Het
Kdm5d G A Y: 941,282 R1161H probably damaging Het
Map4 T C 9: 110,068,580 S675P probably benign Het
Mfsd4b3 A T 10: 39,947,226 V346E probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr867 T A 9: 20,055,461 M1L probably benign Het
P2rx1 A C 11: 73,012,958 K282T probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Ptprj A T 2: 90,444,414 probably null Het
Pwp1 A G 10: 85,885,862 I411V probably benign Het
Rnaset2b T C 17: 6,988,770 S12P probably damaging Het
Rrs1 C A 1: 9,545,801 probably null Het
Ryr2 T C 13: 11,759,703 E1189G probably damaging Het
Slc25a21 T A 12: 56,738,487 I202F probably benign Het
Tcfl5 A G 2: 180,622,647 V472A probably benign Het
Ttc12 A T 9: 49,458,187 probably benign Het
Ugt2b1 T G 5: 86,926,129 I124L probably benign Het
Usp14 A T 18: 9,997,763 N357K probably benign Het
Other mutations in Olfr50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Olfr50 APN 2 36794000 missense probably benign 0.05
IGL02316:Olfr50 APN 2 36793620 missense probably damaging 0.98
IGL02330:Olfr50 APN 2 36793895 missense probably benign 0.00
IGL03144:Olfr50 APN 2 36794081 missense probably benign 0.44
R0092:Olfr50 UTSW 2 36793496 missense probably benign 0.06
R0113:Olfr50 UTSW 2 36793994 missense probably damaging 0.98
R0113:Olfr50 UTSW 2 36793995 missense probably damaging 0.99
R0604:Olfr50 UTSW 2 36794107 nonsense probably null
R0932:Olfr50 UTSW 2 36793891 nonsense probably null
R1191:Olfr50 UTSW 2 36793338 missense probably damaging 0.97
R1525:Olfr50 UTSW 2 36794143 missense probably null 0.01
R3103:Olfr50 UTSW 2 36793562 missense possibly damaging 0.80
R3955:Olfr50 UTSW 2 36793553 missense probably benign 0.34
R4573:Olfr50 UTSW 2 36793479 missense probably damaging 1.00
R5256:Olfr50 UTSW 2 36793673 missense probably benign
R5650:Olfr50 UTSW 2 36793265 missense probably benign 0.36
R6130:Olfr50 UTSW 2 36794043 missense probably benign 0.01
R6175:Olfr50 UTSW 2 36793968 missense probably damaging 1.00
R6320:Olfr50 UTSW 2 36793573 missense possibly damaging 0.90
R6481:Olfr50 UTSW 2 36793777 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ATTAGGCTGGACTCTCACCTCCAC -3'
(R):5'- AGCTTCAGCAAAGCAGAGAGATCAC -3'

Sequencing Primer
(F):5'- CCACACCCCCATGTACTTC -3'
(R):5'- TCACAGAAAAAATGGTGGACAGTG -3'
Posted On2014-01-29