Incidental Mutation 'R1238:Cep70'
ID152500
Institutional Source Beutler Lab
Gene Symbol Cep70
Ensembl Gene ENSMUSG00000056267
Gene Namecentrosomal protein 70
SynonymsC030018L16Rik, 6720484E09Rik
MMRRC Submission 039305-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.362) question?
Stock #R1238 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location99243367-99300404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99254265 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 7 (I7T)
Ref Sequence ENSEMBL: ENSMUSP00000139816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093795] [ENSMUST00000185799] [ENSMUST00000190078] [ENSMUST00000190715] [ENSMUST00000191014] [ENSMUST00000191335]
Predicted Effect probably benign
Transcript: ENSMUST00000093795
AA Change: I7T

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000091312
Gene: ENSMUSG00000056267
AA Change: I7T

DomainStartEndE-ValueType
coiled coil region 96 210 N/A INTRINSIC
coiled coil region 278 299 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 528 544 N/A INTRINSIC
low complexity region 591 602 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185799
AA Change: I7T

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000139458
Gene: ENSMUSG00000056267
AA Change: I7T

DomainStartEndE-ValueType
coiled coil region 96 156 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189371
Predicted Effect probably benign
Transcript: ENSMUST00000190078
AA Change: I7T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000190715
AA Change: I7T

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140377
Gene: ENSMUSG00000056267
AA Change: I7T

DomainStartEndE-ValueType
coiled coil region 96 157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191014
AA Change: I7T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000191335
AA Change: I7T

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000139816
Gene: ENSMUSG00000056267
AA Change: I7T

DomainStartEndE-ValueType
coiled coil region 96 210 N/A INTRINSIC
coiled coil region 278 299 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 528 544 N/A INTRINSIC
Meta Mutation Damage Score 0.0516 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 G A 14: 118,597,639 probably benign Het
BC051665 T A 13: 60,784,637 N78I probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cep290 A C 10: 100,517,863 Q819H probably damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Cit T A 5: 115,851,221 F56I probably benign Het
Colec10 T C 15: 54,462,439 F222L possibly damaging Het
Crocc G A 4: 141,035,364 A769V probably benign Het
Ctcf T C 8: 105,671,277 probably benign Het
Ect2l T C 10: 18,143,104 R607G possibly damaging Het
Efcab6 T G 15: 83,933,137 E745A probably benign Het
Eif1ad T G 19: 5,370,083 *171G probably null Het
Gm4759 A G 7: 106,423,057 V246A probably damaging Het
H2-D1 A G 17: 35,263,932 D146G probably damaging Het
Iqub C T 6: 24,505,885 R8H probably benign Het
Itih4 A T 14: 30,887,949 I79F probably damaging Het
Kdm5d G A Y: 941,282 R1161H probably damaging Het
Map4 T C 9: 110,068,580 S675P probably benign Het
Mfsd4b3 A T 10: 39,947,226 V346E probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr50 A T 2: 36,793,589 M118L probably damaging Het
Olfr867 T A 9: 20,055,461 M1L probably benign Het
P2rx1 A C 11: 73,012,958 K282T probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Ptprj A T 2: 90,444,414 probably null Het
Pwp1 A G 10: 85,885,862 I411V probably benign Het
Rnaset2b T C 17: 6,988,770 S12P probably damaging Het
Rrs1 C A 1: 9,545,801 probably null Het
Ryr2 T C 13: 11,759,703 E1189G probably damaging Het
Slc25a21 T A 12: 56,738,487 I202F probably benign Het
Tcfl5 A G 2: 180,622,647 V472A probably benign Het
Ttc12 A T 9: 49,458,187 probably benign Het
Ugt2b1 T G 5: 86,926,129 I124L probably benign Het
Usp14 A T 18: 9,997,763 N357K probably benign Het
Other mutations in Cep70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01445:Cep70 APN 9 99298500 unclassified probably benign
IGL02719:Cep70 APN 9 99275722 missense probably damaging 0.99
IGL02878:Cep70 APN 9 99281107 splice site probably benign
IGL02969:Cep70 APN 9 99298504 missense possibly damaging 0.88
R0426:Cep70 UTSW 9 99297684 missense probably benign 0.02
R0970:Cep70 UTSW 9 99275599 missense possibly damaging 0.93
R1462:Cep70 UTSW 9 99263720 missense probably benign 0.20
R1462:Cep70 UTSW 9 99263720 missense probably benign 0.20
R2141:Cep70 UTSW 9 99296385 missense probably damaging 1.00
R3922:Cep70 UTSW 9 99275579 makesense probably null
R3964:Cep70 UTSW 9 99298534 missense probably damaging 1.00
R3965:Cep70 UTSW 9 99298534 missense probably damaging 1.00
R4044:Cep70 UTSW 9 99262609 missense possibly damaging 0.66
R4174:Cep70 UTSW 9 99246313 start gained probably benign
R4659:Cep70 UTSW 9 99296341 missense possibly damaging 0.86
R4672:Cep70 UTSW 9 99254312 missense possibly damaging 0.66
R4839:Cep70 UTSW 9 99296085 missense probably benign 0.16
R5108:Cep70 UTSW 9 99263812 splice site probably null
R5288:Cep70 UTSW 9 99281075 missense probably damaging 1.00
R5386:Cep70 UTSW 9 99281075 missense probably damaging 1.00
R5802:Cep70 UTSW 9 99296405 missense probably damaging 0.96
R5934:Cep70 UTSW 9 99254265 missense probably benign 0.05
R6076:Cep70 UTSW 9 99298505 missense probably damaging 1.00
R6848:Cep70 UTSW 9 99262901 missense probably benign 0.34
R6977:Cep70 UTSW 9 99291676 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTCAGTGAGGGTAACCCTACG -3'
(R):5'- TGCACACCTAGCAGTCTTTTGAACA -3'

Sequencing Primer
(F):5'- ctgttcctcctgccgcc -3'
(R):5'- CCTAGCAGTCTTTTGAACATACTTTG -3'
Posted On2014-01-29