Incidental Mutation 'R1238:Kdm5d'
ID152519
Institutional Source Beutler Lab
Gene Symbol Kdm5d
Ensembl Gene ENSMUSG00000056673
Gene Namelysine (K)-specific demethylase 5D
SynonymsJarid1d, Smcy, HY
MMRRC Submission 039305-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1238 (G1)
Quality Score222
Status Validated
ChromosomeY
Chromosomal Location897788-956786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 941282 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1161 (R1161H)
Ref Sequence ENSEMBL: ENSMUSP00000061095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055032] [ENSMUST00000186696] [ENSMUST00000186726]
Predicted Effect probably damaging
Transcript: ENSMUST00000055032
AA Change: R1161H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000061095
Gene: ENSMUSG00000056673
AA Change: R1161H

DomainStartEndE-ValueType
JmjN 13 54 3.45e-23 SMART
ARID 76 165 4.84e-36 SMART
BRIGHT 80 170 4.48e-38 SMART
PHD 325 371 8.56e-13 SMART
JmjC 467 633 2.52e-63 SMART
Pfam:zf-C5HC2 706 758 5.2e-18 PFAM
Pfam:PLU-1 771 1096 1.4e-89 PFAM
low complexity region 1147 1156 N/A INTRINSIC
low complexity region 1164 1181 N/A INTRINSIC
PHD 1182 1243 2.54e-6 SMART
coiled coil region 1290 1318 N/A INTRINSIC
low complexity region 1340 1351 N/A INTRINSIC
low complexity region 1395 1406 N/A INTRINSIC
low complexity region 1453 1459 N/A INTRINSIC
low complexity region 1525 1541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186696
SMART Domains Protein: ENSMUSP00000140663
Gene: ENSMUSG00000056673

DomainStartEndE-ValueType
JmjN 13 54 3.45e-23 SMART
ARID 76 165 4.84e-36 SMART
BRIGHT 80 170 4.48e-38 SMART
PHD 325 371 8.56e-13 SMART
JmjC 467 633 2.52e-63 SMART
low complexity region 675 689 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186726
SMART Domains Protein: ENSMUSP00000140462
Gene: ENSMUSG00000056673

DomainStartEndE-ValueType
JmjN 13 54 1.4e-25 SMART
ARID 76 165 3.8e-40 SMART
BRIGHT 80 170 2.3e-40 SMART
Blast:ARID 175 260 1e-41 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189955
Meta Mutation Damage Score 0.2816 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing zinc finger domains. A short peptide derived from this protein is a minor histocompatibility antigen which can lead to graft rejection of male donor cells in a female recipient. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 G A 14: 118,597,639 probably benign Het
BC051665 T A 13: 60,784,637 N78I probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cep290 A C 10: 100,517,863 Q819H probably damaging Het
Cep70 T C 9: 99,254,265 I7T probably benign Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Cit T A 5: 115,851,221 F56I probably benign Het
Colec10 T C 15: 54,462,439 F222L possibly damaging Het
Crocc G A 4: 141,035,364 A769V probably benign Het
Ctcf T C 8: 105,671,277 probably benign Het
Ect2l T C 10: 18,143,104 R607G possibly damaging Het
Efcab6 T G 15: 83,933,137 E745A probably benign Het
Eif1ad T G 19: 5,370,083 *171G probably null Het
Gm4759 A G 7: 106,423,057 V246A probably damaging Het
H2-D1 A G 17: 35,263,932 D146G probably damaging Het
Iqub C T 6: 24,505,885 R8H probably benign Het
Itih4 A T 14: 30,887,949 I79F probably damaging Het
Map4 T C 9: 110,068,580 S675P probably benign Het
Mfsd4b3 A T 10: 39,947,226 V346E probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr50 A T 2: 36,793,589 M118L probably damaging Het
Olfr867 T A 9: 20,055,461 M1L probably benign Het
P2rx1 A C 11: 73,012,958 K282T probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Ptprj A T 2: 90,444,414 probably null Het
Pwp1 A G 10: 85,885,862 I411V probably benign Het
Rnaset2b T C 17: 6,988,770 S12P probably damaging Het
Rrs1 C A 1: 9,545,801 probably null Het
Ryr2 T C 13: 11,759,703 E1189G probably damaging Het
Slc25a21 T A 12: 56,738,487 I202F probably benign Het
Tcfl5 A G 2: 180,622,647 V472A probably benign Het
Ttc12 A T 9: 49,458,187 probably benign Het
Ugt2b1 T G 5: 86,926,129 I124L probably benign Het
Usp14 A T 18: 9,997,763 N357K probably benign Het
Other mutations in Kdm5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0013:Kdm5d UTSW Y 941715 missense probably benign 0.37
R0013:Kdm5d UTSW Y 941715 missense probably benign 0.37
R0426:Kdm5d UTSW Y 942437 splice site probably benign
R0486:Kdm5d UTSW Y 927107 missense probably damaging 1.00
R0620:Kdm5d UTSW Y 927330 missense probably damaging 0.98
R0781:Kdm5d UTSW Y 910539 missense probably damaging 1.00
R1015:Kdm5d UTSW Y 941687 missense possibly damaging 0.95
R1110:Kdm5d UTSW Y 910539 missense probably damaging 1.00
R1163:Kdm5d UTSW Y 898029 missense probably benign 0.18
R1203:Kdm5d UTSW Y 941011 missense probably damaging 1.00
R1723:Kdm5d UTSW Y 927753 missense probably damaging 1.00
R1842:Kdm5d UTSW Y 927798 missense probably damaging 1.00
R1885:Kdm5d UTSW Y 940781 splice site probably null
R2131:Kdm5d UTSW Y 941483 missense probably benign 0.02
R2571:Kdm5d UTSW Y 940932 missense probably benign 0.11
R2931:Kdm5d UTSW Y 942992 missense probably benign 0.18
R3123:Kdm5d UTSW Y 900558 missense possibly damaging 0.63
R3919:Kdm5d UTSW Y 939914 missense probably damaging 1.00
R4018:Kdm5d UTSW Y 910441 splice site probably benign
R4031:Kdm5d UTSW Y 916910 missense probably damaging 1.00
R4403:Kdm5d UTSW Y 899830 missense probably damaging 1.00
R4571:Kdm5d UTSW Y 927110 missense probably damaging 1.00
R4583:Kdm5d UTSW Y 914134 missense probably damaging 1.00
R4962:Kdm5d UTSW Y 940624 missense probably damaging 1.00
R5105:Kdm5d UTSW Y 941752 missense probably benign 0.00
R5249:Kdm5d UTSW Y 916692 missense probably damaging 1.00
R5367:Kdm5d UTSW Y 941645 missense probably benign 0.05
R5373:Kdm5d UTSW Y 927995 missense probably benign 0.09
R5374:Kdm5d UTSW Y 927995 missense probably benign 0.09
R5876:Kdm5d UTSW Y 900525 missense probably damaging 1.00
R5909:Kdm5d UTSW Y 941306 missense probably benign 0.01
R6014:Kdm5d UTSW Y 921528 missense probably benign 0.45
R6109:Kdm5d UTSW Y 921501 missense probably damaging 1.00
R6251:Kdm5d UTSW Y 921693 missense probably damaging 1.00
R6349:Kdm5d UTSW Y 916847 missense probably damaging 0.99
R6450:Kdm5d UTSW Y 927056 missense probably damaging 1.00
R6595:Kdm5d UTSW Y 939829 missense probably benign
R6628:Kdm5d UTSW Y 900525 missense probably damaging 1.00
R6745:Kdm5d UTSW Y 927112 missense probably benign 0.28
R6867:Kdm5d UTSW Y 927425 missense probably benign
R6963:Kdm5d UTSW Y 937975 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTGGTAAGCAGCTTGACACAGAG -3'
(R):5'- CCAGCAATGACAAGATGGTCTCCAG -3'

Sequencing Primer
(F):5'- CTTATGGGTATCTCACTGAGAAGAAG -3'
(R):5'- ACAGGAACTTGGTGTCCCATTC -3'
Posted On2014-01-29