Incidental Mutation 'V5622:2510039O18Rik'
ID152521
Institutional Source Beutler Lab
Gene Symbol 2510039O18Rik
Ensembl Gene ENSMUSG00000044496
Gene NameRIKEN cDNA 2510039O18 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #V5622 () of strain 521
Quality Score215
Status Not validated
Chromosome4
Chromosomal Location147940895-147947314 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 147941776 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 251 (S251F)
Ref Sequence ENSEMBL: ENSMUSP00000099522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103232]
Predicted Effect probably benign
Transcript: ENSMUST00000103232
AA Change: S251F

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099522
Gene: ENSMUSG00000044496
AA Change: S251F

DomainStartEndE-ValueType
Pfam:DUF2152 6 629 2.9e-251 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 9 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccar2 G T 14: 70,151,289 L158I probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Homo
Hspg2 C A 4: 137,533,738 Q1648K probably damaging Het
Hvcn1 TGAGGAGGAGGAGGAGGAG TGAGGAGGAGGAGGAG 5: 122,233,539 probably benign Het
Megf11 C A 9: 64,690,069 C674* probably null Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Naip2 G A 13: 100,155,029 probably benign Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb12 C A 17: 34,896,301 A354E possibly damaging Het
Other mutations in 2510039O18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:2510039O18Rik APN 4 147945064 missense probably damaging 1.00
R1135:2510039O18Rik UTSW 4 147944658 missense probably benign 0.26
R1546:2510039O18Rik UTSW 4 147941775 missense probably damaging 0.97
R2008:2510039O18Rik UTSW 4 147941577 missense probably benign 0.31
R2437:2510039O18Rik UTSW 4 147946618 makesense probably null
R3937:2510039O18Rik UTSW 4 147942053 missense possibly damaging 0.54
R3970:2510039O18Rik UTSW 4 147945322 missense probably damaging 0.99
R3973:2510039O18Rik UTSW 4 147945031 missense probably damaging 1.00
R3974:2510039O18Rik UTSW 4 147945031 missense probably damaging 1.00
R4050:2510039O18Rik UTSW 4 147944992 missense probably damaging 1.00
R4431:2510039O18Rik UTSW 4 147941565 missense probably benign 0.01
R4750:2510039O18Rik UTSW 4 147941488 missense probably damaging 0.99
R4943:2510039O18Rik UTSW 4 147945098 missense probably damaging 1.00
R5139:2510039O18Rik UTSW 4 147945448 missense probably damaging 0.98
R6735:2510039O18Rik UTSW 4 147941817 missense probably benign
R7139:2510039O18Rik UTSW 4 147941838 missense possibly damaging 0.90
V5088:2510039O18Rik UTSW 4 147941776 missense probably benign 0.18
V5622:2510039O18Rik UTSW 4 147941776 missense probably benign 0.18
Z1088:2510039O18Rik UTSW 4 147944745 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCAGCTACGCCCGCTGAATGT -3'
(R):5'- GCCCAGAGGTACTGGTGATCCTGAA -3'

Sequencing Primer
(F):5'- GGGACTGCGTGCTACTG -3'
(R):5'- TACTGGTGATCCTGAAGCAGC -3'
Posted On2014-01-29