Incidental Mutation 'V7582:Atp6v1h'
ID152583
Institutional Source Beutler Lab
Gene Symbol Atp6v1h
Ensembl Gene ENSMUSG00000033793
Gene NameATPase, H+ transporting, lysosomal V1 subunit H
Synonyms0710001F19Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.912) question?
Stock #V7582 () of strain stinger
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location5070018-5162529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5124443 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 282 (T282A)
Ref Sequence ENSEMBL: ENSMUSP00000141636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044369] [ENSMUST00000192698] [ENSMUST00000192847]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044369
AA Change: T282A

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040756
Gene: ENSMUSG00000033793
AA Change: T282A

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 17 342 3e-106 PFAM
Pfam:V-ATPase_H_C 348 464 1.9e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000192698
AA Change: T264A

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141797
Gene: ENSMUSG00000033793
AA Change: T264A

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 17 324 4.4e-104 PFAM
Pfam:V-ATPase_H_C 329 447 1.7e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000192847
AA Change: T282A

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141636
Gene: ENSMUSG00000033793
AA Change: T282A

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 17 342 1e-102 PFAM
Pfam:V-ATPase_H_C 332 423 2.7e-25 PFAM
Pfam:Arm_2 339 427 4.6e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194301
Meta Mutation Damage Score 0.21 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular organelles. V-ATPase-dependent organelle acidification is necessary for multiple processes including protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. The encoded protein is the regulatory H subunit of the V1 domain of V-ATPase, which is required for catalysis of ATP but not the assembly of V-ATPase. Decreased expression of this gene may play a role in the development of type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for the allele exhbit bone loss with altered bone absorption and decreased bone formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Ahcy G A 2: 155,064,921 R151* probably null Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fbrsl1 C T 5: 110,379,426 A129T possibly damaging Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Hira G A 16: 18,894,821 A29T probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Med20 G A 17: 47,618,832 V65M probably damaging Het
Myrfl T C 10: 116,861,530 T30A probably damaging Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Rbbp8nl T A 2: 180,278,208 T558S probably benign Het
Rundc3b TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 5: 8,622,549 probably benign Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Thbd A T 2: 148,407,190 Y253N probably benign Het
Tiam1 C T 16: 89,865,271 R653H probably damaging Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Other mutations in Atp6v1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Atp6v1h APN 1 5124471 critical splice donor site probably null
IGL00984:Atp6v1h APN 1 5095682 missense probably damaging 1.00
IGL01545:Atp6v1h APN 1 5089059 missense probably benign
IGL01788:Atp6v1h APN 1 5149983 missense possibly damaging 0.81
IGL02317:Atp6v1h APN 1 5084470 missense possibly damaging 0.95
IGL02679:Atp6v1h APN 1 5124302 missense probably damaging 1.00
IGL02944:Atp6v1h APN 1 5093355 splice site probably benign
IGL03119:Atp6v1h APN 1 5095669 missense probably benign 0.34
F5770:Atp6v1h UTSW 1 5124443 missense possibly damaging 0.94
R0055:Atp6v1h UTSW 1 5084454 missense probably benign 0.01
R0055:Atp6v1h UTSW 1 5084454 missense probably benign 0.01
R0727:Atp6v1h UTSW 1 5084558 nonsense probably null
R1452:Atp6v1h UTSW 1 5098137 unclassified probably benign
R1465:Atp6v1h UTSW 1 5095688 missense probably damaging 1.00
R1465:Atp6v1h UTSW 1 5095688 missense probably damaging 1.00
R2273:Atp6v1h UTSW 1 5117476 missense probably damaging 1.00
R4512:Atp6v1h UTSW 1 5098135 critical splice donor site probably null
R4687:Atp6v1h UTSW 1 5133085 missense probably damaging 1.00
R5185:Atp6v1h UTSW 1 5095642 missense probably damaging 1.00
R5628:Atp6v1h UTSW 1 5135889 nonsense probably null
R5843:Atp6v1h UTSW 1 5162089 intron probably null
V7580:Atp6v1h UTSW 1 5124443 missense possibly damaging 0.94
V7581:Atp6v1h UTSW 1 5124443 missense possibly damaging 0.94
V7583:Atp6v1h UTSW 1 5124443 missense possibly damaging 0.94
Z1088:Atp6v1h UTSW 1 5098048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAGTTTCCATGCCTTCCAGAG -3'
(R):5'- TAGTCCTGTAGCAGGCACTGTAGC -3'

Sequencing Primer
(F):5'- TCCAGAGGGAGGTTTATAATTTAGC -3'
(R):5'- GGGTACTTTCTCCATCTGAATATAAC -3'
Posted On2014-01-29