Incidental Mutation 'V7582:Olfr1406'
ID152585
Institutional Source Beutler Lab
Gene Symbol Olfr1406
Ensembl Gene ENSMUSG00000058981
Gene Nameolfactory receptor 1406
SynonymsMOR267-5, GA_x6K02T2R7CC-664297-665229
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #V7582 () of strain stinger
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location173181853-173190640 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 173183964 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 157 (L157I)
Ref Sequence ENSEMBL: ENSMUSP00000151023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072395] [ENSMUST00000201132] [ENSMUST00000215878]
Predicted Effect probably benign
Transcript: ENSMUST00000072395
AA Change: L157I

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000072231
Gene: ENSMUSG00000058981
AA Change: L157I

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.9e-55 PFAM
Pfam:7tm_1 41 289 2.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201132
AA Change: L157I

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144530
Gene: ENSMUSG00000058981
AA Change: L157I

DomainStartEndE-ValueType
Pfam:7tm_4 31 88 5.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215878
AA Change: L157I

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.1248 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Ahcy G A 2: 155,064,921 R151* probably null Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fbrsl1 C T 5: 110,379,426 A129T possibly damaging Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Hira G A 16: 18,894,821 A29T probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Med20 G A 17: 47,618,832 V65M probably damaging Het
Myrfl T C 10: 116,861,530 T30A probably damaging Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Rbbp8nl T A 2: 180,278,208 T558S probably benign Het
Rundc3b TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 5: 8,622,549 probably benign Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Thbd A T 2: 148,407,190 Y253N probably benign Het
Tiam1 C T 16: 89,865,271 R653H probably damaging Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Other mutations in Olfr1406
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Olfr1406 APN 1 173183623 missense probably benign 0.45
IGL01609:Olfr1406 APN 1 173184276 missense probably benign 0.00
IGL01996:Olfr1406 APN 1 173183727 missense probably benign 0.00
F5770:Olfr1406 UTSW 1 173183964 missense probably benign 0.05
R0053:Olfr1406 UTSW 1 173184278 missense probably benign 0.35
R0800:Olfr1406 UTSW 1 173184060 missense probably damaging 1.00
R1793:Olfr1406 UTSW 1 173184409 missense probably benign
R2230:Olfr1406 UTSW 1 173183615 missense probably benign 0.04
R2232:Olfr1406 UTSW 1 173183615 missense probably benign 0.04
R5395:Olfr1406 UTSW 1 173183680 nonsense probably null
R5455:Olfr1406 UTSW 1 173184251 missense probably damaging 1.00
R5457:Olfr1406 UTSW 1 173183613 missense probably damaging 1.00
R5558:Olfr1406 UTSW 1 173184018 missense probably benign 0.01
R5760:Olfr1406 UTSW 1 173183751 missense probably benign 0.05
R6285:Olfr1406 UTSW 1 173183910 missense probably damaging 1.00
V7580:Olfr1406 UTSW 1 173183964 missense probably benign 0.05
V7581:Olfr1406 UTSW 1 173183964 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGGCTGTGATGACCATAAGGCTAAG -3'
(R):5'- TGACCATTATCCGCATTGACCACC -3'

Sequencing Primer
(F):5'- TGACCATAAGGCTAAGAGCTAAC -3'
(R):5'- TTGTAGGTCTGAGCCAAACC -3'
Posted On2014-01-29