Incidental Mutation 'V7582:Erv3'
ID152588
Institutional Source Beutler Lab
Gene Symbol Erv3
Ensembl Gene ENSMUSG00000037482
Gene Nameendogenous retroviral sequence 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #V7582 () of strain stinger
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location131853678-131859747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131855926 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 171 (H171R)
Ref Sequence ENSEMBL: ENSMUSP00000047030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040941]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040941
AA Change: H171R

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047030
Gene: ENSMUSG00000037482
AA Change: H171R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Meta Mutation Damage Score 0.0516 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Ahcy G A 2: 155,064,921 R151* probably null Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fbrsl1 C T 5: 110,379,426 A129T possibly damaging Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Hira G A 16: 18,894,821 A29T probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Med20 G A 17: 47,618,832 V65M probably damaging Het
Myrfl T C 10: 116,861,530 T30A probably damaging Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Rbbp8nl T A 2: 180,278,208 T558S probably benign Het
Rundc3b TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 5: 8,622,549 probably benign Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Thbd A T 2: 148,407,190 Y253N probably benign Het
Tiam1 C T 16: 89,865,271 R653H probably damaging Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Other mutations in Erv3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Erv3 APN 2 131855957 nonsense probably null
IGL02034:Erv3 APN 2 131856014 missense possibly damaging 0.46
F5770:Erv3 UTSW 2 131855926 missense possibly damaging 0.66
R1518:Erv3 UTSW 2 131856163 missense probably benign 0.04
R6036:Erv3 UTSW 2 131856005 missense possibly damaging 0.46
R6036:Erv3 UTSW 2 131856005 missense possibly damaging 0.46
R6045:Erv3 UTSW 2 131856022 missense probably damaging 0.97
R6988:Erv3 UTSW 2 131855966 missense possibly damaging 0.90
V7580:Erv3 UTSW 2 131855926 missense possibly damaging 0.66
V7581:Erv3 UTSW 2 131855926 missense possibly damaging 0.66
V7583:Erv3 UTSW 2 131855926 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GTTCAGGACCAACGATCAGGCATAG -3'
(R):5'- TCCACACTGGGGCTGCAAATATC -3'

Sequencing Primer
(F):5'- TTAGCAACTCAAAGGCGGTC -3'
(R):5'- ATCATAGTACTTGGCCCAGATGG -3'
Posted On2014-01-29