Incidental Mutation 'V7582:Ahcy'
ID152590
Institutional Source Beutler Lab
Gene Symbol Ahcy
Ensembl Gene ENSMUSG00000027597
Gene NameS-adenosylhomocysteine hydrolase
SynonymsCuBP, SAHH
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #V7582 () of strain stinger
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location155059310-155074497 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 155064921 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 151 (R151*)
Ref Sequence ENSEMBL: ENSMUSP00000061851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054607] [ENSMUST00000137242]
Predicted Effect probably null
Transcript: ENSMUST00000054607
AA Change: R151*
SMART Domains Protein: ENSMUSP00000061851
Gene: ENSMUSG00000027597
AA Change: R151*

DomainStartEndE-ValueType
AdoHcyase 6 431 N/A SMART
AdoHcyase_NAD 191 352 1.49e-118 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137242
SMART Domains Protein: ENSMUSP00000116774
Gene: ENSMUSG00000027597

DomainStartEndE-ValueType
Pfam:AdoHcyase 5 95 1.4e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146367
Meta Mutation Damage Score 0.622 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomocysteine (SAH) concentration thought to be important for transmethylation reactions. Deficiency in this protein is one of the different causes of hypermethioninemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: See the ax allele for a deletion that includes the Ahcy gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fbrsl1 C T 5: 110,379,426 A129T possibly damaging Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Hira G A 16: 18,894,821 A29T probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Med20 G A 17: 47,618,832 V65M probably damaging Het
Myrfl T C 10: 116,861,530 T30A probably damaging Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Rbbp8nl T A 2: 180,278,208 T558S probably benign Het
Rundc3b TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 5: 8,622,549 probably benign Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Thbd A T 2: 148,407,190 Y253N probably benign Het
Tiam1 C T 16: 89,865,271 R653H probably damaging Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Other mutations in Ahcy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Ahcy APN 2 155067361 missense probably benign 0.26
IGL03001:Ahcy APN 2 155064828 missense probably damaging 1.00
F5770:Ahcy UTSW 2 155064921 nonsense probably null
R1226:Ahcy UTSW 2 155064897 missense probably benign 0.01
R1572:Ahcy UTSW 2 155068931 missense probably benign 0.06
R1741:Ahcy UTSW 2 155064234 missense probably benign 0.29
R1879:Ahcy UTSW 2 155064152 critical splice donor site probably null
R1898:Ahcy UTSW 2 155062253 missense probably benign 0.20
R4743:Ahcy UTSW 2 155068968 missense probably damaging 1.00
R4861:Ahcy UTSW 2 155060516 missense probably benign 0.05
R4861:Ahcy UTSW 2 155060516 missense probably benign 0.05
R6114:Ahcy UTSW 2 155062159 missense probably damaging 1.00
X0067:Ahcy UTSW 2 155068952 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAAGCCATGATACCTGAAGCAGC -3'
(R):5'- AGAGTGCATCAGATGACACCTCCC -3'

Sequencing Primer
(F):5'- GACTAAGTAAGAGCTTCATGTCCC -3'
(R):5'- TGACACCTCCCTGGGTGAC -3'
Posted On2014-01-29