Incidental Mutation 'V7582:Rbbp8nl'
ID152591
Institutional Source Beutler Lab
Gene Symbol Rbbp8nl
Ensembl Gene ENSMUSG00000038980
Gene NameRBBP8 N-terminal like
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.027) question?
Stock #V7582 () of strain stinger
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location180277646-180289879 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 180278208 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 558 (T558S)
Ref Sequence ENSEMBL: ENSMUSP00000047237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038529] [ENSMUST00000108891]
Predicted Effect probably benign
Transcript: ENSMUST00000038529
AA Change: T558S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000047237
Gene: ENSMUSG00000038980
AA Change: T558S

DomainStartEndE-ValueType
Pfam:CtIP_N 4 123 5.6e-56 PFAM
low complexity region 143 154 N/A INTRINSIC
low complexity region 157 172 N/A INTRINSIC
low complexity region 237 250 N/A INTRINSIC
low complexity region 282 296 N/A INTRINSIC
low complexity region 352 361 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 585 590 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108891
SMART Domains Protein: ENSMUSP00000104519
Gene: ENSMUSG00000038990

DomainStartEndE-ValueType
low complexity region 2 39 N/A INTRINSIC
low complexity region 58 102 N/A INTRINSIC
low complexity region 116 121 N/A INTRINSIC
low complexity region 262 276 N/A INTRINSIC
CYCLIN 365 452 1.55e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136706
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Ahcy G A 2: 155,064,921 R151* probably null Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fbrsl1 C T 5: 110,379,426 A129T possibly damaging Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Hira G A 16: 18,894,821 A29T probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Med20 G A 17: 47,618,832 V65M probably damaging Het
Myrfl T C 10: 116,861,530 T30A probably damaging Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Rundc3b TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 5: 8,622,549 probably benign Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Thbd A T 2: 148,407,190 Y253N probably benign Het
Tiam1 C T 16: 89,865,271 R653H probably damaging Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Other mutations in Rbbp8nl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01802:Rbbp8nl APN 2 180279695 missense probably benign 0.01
IGL01845:Rbbp8nl APN 2 180283311 missense probably damaging 0.99
IGL01966:Rbbp8nl APN 2 180280989 splice site probably benign
IGL02217:Rbbp8nl APN 2 180278188 unclassified probably benign
IGL02500:Rbbp8nl APN 2 180279329 missense possibly damaging 0.57
IGL02623:Rbbp8nl APN 2 180281443 missense probably damaging 0.99
IGL02634:Rbbp8nl APN 2 180280895 missense probably benign 0.00
F5770:Rbbp8nl UTSW 2 180278208 missense probably benign 0.03
R0380:Rbbp8nl UTSW 2 180281719 missense probably damaging 0.96
R1773:Rbbp8nl UTSW 2 180281194 missense probably benign 0.00
R1858:Rbbp8nl UTSW 2 180282213 splice site probably benign
R1901:Rbbp8nl UTSW 2 180283313 missense probably damaging 1.00
R1962:Rbbp8nl UTSW 2 180280874 missense probably benign 0.03
R2423:Rbbp8nl UTSW 2 180280971 missense probably damaging 0.98
R2495:Rbbp8nl UTSW 2 180279102 missense probably null 0.31
R3738:Rbbp8nl UTSW 2 180281248 missense probably benign 0.37
R4460:Rbbp8nl UTSW 2 180280971 missense probably benign 0.41
R4502:Rbbp8nl UTSW 2 180279196 missense possibly damaging 0.48
R5573:Rbbp8nl UTSW 2 180279793 missense possibly damaging 0.95
R5699:Rbbp8nl UTSW 2 180278668 missense probably damaging 0.98
R6242:Rbbp8nl UTSW 2 180280974 missense probably damaging 1.00
R6269:Rbbp8nl UTSW 2 180281512 nonsense probably null
R6586:Rbbp8nl UTSW 2 180280959 missense probably damaging 1.00
R6875:Rbbp8nl UTSW 2 180279226 missense probably benign 0.00
V7581:Rbbp8nl UTSW 2 180278208 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTATCAGGCTCCAACTGGAACCC -3'
(R):5'- AGCCCCTCTATGTCCTCATCTGAAG -3'

Sequencing Primer
(F):5'- GGAACCCAGATGCTATTCTCCAG -3'
(R):5'- GTCCTCATCTGAAGAGTCATTATTC -3'
Posted On2014-01-29