Incidental Mutation 'V7582:Zfp933'
ID152599
Institutional Source Beutler Lab
Gene Symbol Zfp933
Ensembl Gene ENSMUSG00000059423
Gene Namezinc finger protein 933
Synonyms2810408P10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #V7582 () of strain stinger
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location147822986-147848366 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 147826470 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 223 (A223V)
Ref Sequence ENSEMBL: ENSMUSP00000101343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105718] [ENSMUST00000135798]
Predicted Effect probably damaging
Transcript: ENSMUST00000105718
AA Change: A223V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101343
Gene: ENSMUSG00000059423
AA Change: A223V

DomainStartEndE-ValueType
KRAB 4 66 9.49e-16 SMART
ZnF_C2H2 131 153 3.21e-4 SMART
ZnF_C2H2 159 181 5.21e-4 SMART
ZnF_C2H2 187 209 2.12e-4 SMART
ZnF_C2H2 215 237 7.26e-3 SMART
ZnF_C2H2 243 265 6.88e-4 SMART
ZnF_C2H2 271 293 1.13e-4 SMART
ZnF_C2H2 299 321 3.95e-4 SMART
ZnF_C2H2 327 349 1.56e-2 SMART
ZnF_C2H2 355 377 1.79e-2 SMART
ZnF_C2H2 383 405 4.24e-4 SMART
ZnF_C2H2 411 433 1.22e-4 SMART
ZnF_C2H2 439 461 4.79e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116174
Predicted Effect probably benign
Transcript: ENSMUST00000135798
SMART Domains Protein: ENSMUSP00000118300
Gene: ENSMUSG00000059423

DomainStartEndE-ValueType
Blast:KRAB 1 34 8e-18 BLAST
PDB:2I13|B 32 98 1e-12 PDB
SCOP:d1fgja_ 33 98 5e-13 SMART
Blast:PHD 44 98 6e-11 BLAST
Meta Mutation Damage Score 0.226 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Ahcy G A 2: 155,064,921 R151* probably null Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fbrsl1 C T 5: 110,379,426 A129T possibly damaging Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Hira G A 16: 18,894,821 A29T probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Med20 G A 17: 47,618,832 V65M probably damaging Het
Myrfl T C 10: 116,861,530 T30A probably damaging Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Rbbp8nl T A 2: 180,278,208 T558S probably benign Het
Rundc3b TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 5: 8,622,549 probably benign Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Thbd A T 2: 148,407,190 Y253N probably benign Het
Tiam1 C T 16: 89,865,271 R653H probably damaging Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Other mutations in Zfp933
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Zfp933 APN 4 147826321 missense probably damaging 1.00
IGL03377:Zfp933 APN 4 147828711 missense possibly damaging 0.65
F5770:Zfp933 UTSW 4 147826470 missense probably damaging 0.98
FR4340:Zfp933 UTSW 4 147825729 frame shift probably null
FR4548:Zfp933 UTSW 4 147825731 frame shift probably null
R0388:Zfp933 UTSW 4 147826442 missense probably benign 0.35
R0523:Zfp933 UTSW 4 147826462 nonsense probably null
R0539:Zfp933 UTSW 4 147826548 missense probably benign 0.08
R1672:Zfp933 UTSW 4 147826019 missense probably damaging 1.00
R4049:Zfp933 UTSW 4 147826512 missense probably damaging 1.00
R4895:Zfp933 UTSW 4 147826435 nonsense probably null
R5133:Zfp933 UTSW 4 147826864 missense probably benign
R5786:Zfp933 UTSW 4 147828407 splice site probably null
R5891:Zfp933 UTSW 4 147826774 missense probably benign 0.03
R6111:Zfp933 UTSW 4 147828760 missense probably damaging 1.00
R6382:Zfp933 UTSW 4 147825868 missense probably benign 0.07
R6968:Zfp933 UTSW 4 147826197 missense probably damaging 1.00
V7581:Zfp933 UTSW 4 147826470 missense probably damaging 0.98
V7583:Zfp933 UTSW 4 147826470 missense probably damaging 0.98
Predicted Primers
Posted On2014-01-29