Incidental Mutation 'V7582:Rundc3b'
ID152601
Institutional Source Beutler Lab
Gene Symbol Rundc3b
Ensembl Gene ENSMUSG00000040570
Gene NameRUN domain containing 3B
SynonymsLOC242819
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #V7582 () of strain stinger
Quality Score117
Status Not validated
Chromosome5
Chromosomal Location8490334-8622952 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) TGCCGCCGCCGCCGCCGCCGCCGCCGC to TGCCGCCGCCGCCGCCGCCGCCGC at 8622549 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047485] [ENSMUST00000115378]
Predicted Effect probably benign
Transcript: ENSMUST00000047485
SMART Domains Protein: ENSMUSP00000040108
Gene: ENSMUSG00000040570

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
RUN 126 188 3.28e-23 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 270 278 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115378
SMART Domains Protein: ENSMUSP00000111036
Gene: ENSMUSG00000040570

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
RUN 126 188 3.28e-23 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 270 278 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Ahcy G A 2: 155,064,921 R151* probably null Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fbrsl1 C T 5: 110,379,426 A129T possibly damaging Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Hira G A 16: 18,894,821 A29T probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Med20 G A 17: 47,618,832 V65M probably damaging Het
Myrfl T C 10: 116,861,530 T30A probably damaging Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Rbbp8nl T A 2: 180,278,208 T558S probably benign Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Thbd A T 2: 148,407,190 Y253N probably benign Het
Tiam1 C T 16: 89,865,271 R653H probably damaging Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Other mutations in Rundc3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Rundc3b APN 5 8569553 missense probably damaging 0.98
IGL01726:Rundc3b APN 5 8520902 missense probably benign 0.24
IGL02271:Rundc3b APN 5 8492530 missense probably damaging 1.00
IGL03394:Rundc3b APN 5 8548261 missense possibly damaging 0.93
F5770:Rundc3b UTSW 5 8622549 small deletion probably benign
R0656:Rundc3b UTSW 5 8569529 missense probably damaging 1.00
R1702:Rundc3b UTSW 5 8512318 missense probably benign
R1776:Rundc3b UTSW 5 8579050 missense probably damaging 1.00
R1829:Rundc3b UTSW 5 8579117 missense probably damaging 1.00
R2011:Rundc3b UTSW 5 8512409 critical splice acceptor site probably null
R3606:Rundc3b UTSW 5 8512386 missense probably damaging 1.00
R4841:Rundc3b UTSW 5 8528742 missense probably damaging 1.00
R6452:Rundc3b UTSW 5 8579175 intron probably null
R6642:Rundc3b UTSW 5 8579071 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCACAGGGATTTGGGGACATC -3'
(R):5'- TGCCATCGTTGAGAGAAGGCCG -3'

Sequencing Primer
(F):5'- GGATTTGGGGACATCTCAGTAACTAC -3'
(R):5'- AGAGAAGGCCGGGGGAC -3'
Posted On2014-01-29