Incidental Mutation 'V7582:Tprkb'
ID152603
Institutional Source Beutler Lab
Gene Symbol Tprkb
Ensembl Gene ENSMUSG00000054226
Gene NameTp53rk binding protein
Synonyms1810034M08Rik, DRWMS1, 0610033G21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #V7582 () of strain stinger
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location85911865-85930284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85928782 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 150 (K150E)
Ref Sequence ENSEMBL: ENSMUSP00000144160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067137] [ENSMUST00000089570] [ENSMUST00000113751] [ENSMUST00000113752] [ENSMUST00000113753] [ENSMUST00000149026] [ENSMUST00000200680] [ENSMUST00000201939] [ENSMUST00000202803]
Predicted Effect probably damaging
Transcript: ENSMUST00000067137
AA Change: K150E

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000063927
Gene: ENSMUSG00000054226
AA Change: K150E

DomainStartEndE-ValueType
Pfam:CGI-121 20 172 1.2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089570
SMART Domains Protein: ENSMUSP00000086998
Gene: ENSMUSG00000054226

DomainStartEndE-ValueType
Pfam:CGI-121 20 150 8.6e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113751
SMART Domains Protein: ENSMUSP00000109380
Gene: ENSMUSG00000054226

DomainStartEndE-ValueType
Pfam:CGI-121 20 91 1.2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113752
AA Change: K150E

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109381
Gene: ENSMUSG00000054226
AA Change: K150E

DomainStartEndE-ValueType
Pfam:CGI-121 20 172 1.3e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113753
AA Change: K150E

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109382
Gene: ENSMUSG00000054226
AA Change: K150E

DomainStartEndE-ValueType
Pfam:CGI-121 20 172 1.2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149026
SMART Domains Protein: ENSMUSP00000117259
Gene: ENSMUSG00000054226

DomainStartEndE-ValueType
Pfam:CGI-121 20 132 1.4e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162660
SMART Domains Protein: ENSMUSP00000124315
Gene: ENSMUSG00000089634

DomainStartEndE-ValueType
low complexity region 46 66 N/A INTRINSIC
Pfam:Acetyltransf_10 84 203 4.6e-11 PFAM
Pfam:Acetyltransf_4 87 214 2.8e-8 PFAM
Pfam:Acetyltransf_7 115 205 1.7e-12 PFAM
Pfam:Acetyltransf_1 122 204 1.5e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200680
AA Change: K150E

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144160
Gene: ENSMUSG00000054226
AA Change: K150E

DomainStartEndE-ValueType
Pfam:CGI-121 20 172 1.3e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201217
Predicted Effect probably benign
Transcript: ENSMUST00000201939
SMART Domains Protein: ENSMUSP00000144588
Gene: ENSMUSG00000054226

DomainStartEndE-ValueType
Pfam:CGI-121 20 110 9.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202803
SMART Domains Protein: ENSMUSP00000144660
Gene: ENSMUSG00000054226

DomainStartEndE-ValueType
Pfam:CGI-121 20 149 1.6e-40 PFAM
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Ahcy G A 2: 155,064,921 R151* probably null Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fbrsl1 C T 5: 110,379,426 A129T possibly damaging Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Hira G A 16: 18,894,821 A29T probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Med20 G A 17: 47,618,832 V65M probably damaging Het
Myrfl T C 10: 116,861,530 T30A probably damaging Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Rbbp8nl T A 2: 180,278,208 T558S probably benign Het
Rundc3b TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 5: 8,622,549 probably benign Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Thbd A T 2: 148,407,190 Y253N probably benign Het
Tiam1 C T 16: 89,865,271 R653H probably damaging Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Other mutations in Tprkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02133:Tprkb APN 6 85927911 missense probably benign 0.00
IGL02981:Tprkb APN 6 85927879 missense probably benign 0.01
IGL03102:Tprkb APN 6 85924418 missense probably benign 0.04
F5770:Tprkb UTSW 6 85928782 missense probably damaging 0.96
R0491:Tprkb UTSW 6 85924464 missense probably benign 0.02
R1456:Tprkb UTSW 6 85924421 missense probably damaging 0.97
R2007:Tprkb UTSW 6 85933048 unclassified probably benign
R2088:Tprkb UTSW 6 85932940 unclassified probably benign
R3960:Tprkb UTSW 6 85928801 missense probably benign 0.02
R6153:Tprkb UTSW 6 85916190 intron probably null
V7581:Tprkb UTSW 6 85928782 missense probably damaging 0.96
V7583:Tprkb UTSW 6 85928782 missense probably damaging 0.96
X0064:Tprkb UTSW 6 85928800 missense probably benign 0.39
X0064:Tprkb UTSW 6 85928802 missense probably benign
Predicted Primers
Posted On2014-01-29