Incidental Mutation 'V7582:Myrfl'
ID152610
Institutional Source Beutler Lab
Gene Symbol Myrfl
Ensembl Gene ENSMUSG00000034057
Gene Namemyelin regulatory factor-like
SynonymsLOC237558, Gm239
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock #V7582 () of strain stinger
Quality Score211
Status Not validated
Chromosome10
Chromosomal Location116776535-116896919 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116861530 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 30 (T30A)
Ref Sequence ENSEMBL: ENSMUSP00000037477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048229]
Predicted Effect probably damaging
Transcript: ENSMUST00000048229
AA Change: T30A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000037477
Gene: ENSMUSG00000034057
AA Change: T30A

DomainStartEndE-ValueType
Pfam:NDT80_PhoG 252 399 3.4e-29 PFAM
Pfam:Peptidase_S74 446 505 1.6e-18 PFAM
Pfam:MRF_C1 525 560 1.8e-24 PFAM
low complexity region 562 601 N/A INTRINSIC
transmembrane domain 625 647 N/A INTRINSIC
low complexity region 663 691 N/A INTRINSIC
Pfam:MRF_C2 765 903 4e-53 PFAM
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Ahcy G A 2: 155,064,921 R151* probably null Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fbrsl1 C T 5: 110,379,426 A292T possibly damaging Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Hira G A 16: 18,894,821 A29T probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Med20 G A 17: 47,618,832 V65M probably damaging Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Otop3 T A 11: 115,344,838 L451Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Rbbp8nl T A 2: 180,278,208 T558S probably benign Het
Rundc3b TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 5: 8,622,549 probably benign Het
Slc30a4 T A 2: 122,689,538 M185L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Thbd A T 2: 148,407,190 Y253N probably benign Het
Tiam1 C T 16: 89,865,271 R653H probably damaging Het
Tnrc6c G A 11: 117,723,326 R930H probably damaging Het
Toe1 A T 4: 116,806,111 N122K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Other mutations in Myrfl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Myrfl APN 10 116796106 missense possibly damaging 0.46
IGL00824:Myrfl APN 10 116849359 unclassified probably benign
IGL01074:Myrfl APN 10 116779585 missense possibly damaging 0.50
IGL01394:Myrfl APN 10 116822687 missense probably benign 0.01
IGL02283:Myrfl APN 10 116777360 missense probably benign 0.33
IGL02869:Myrfl APN 10 116829004 missense probably damaging 0.98
IGL02878:Myrfl APN 10 116777405 missense possibly damaging 0.70
IGL03112:Myrfl APN 10 116803406 missense probably benign 0.03
F5770:Myrfl UTSW 10 116861530 missense probably damaging 1.00
R0138:Myrfl UTSW 10 116849233 missense probably damaging 0.98
R0402:Myrfl UTSW 10 116828977 missense probably damaging 1.00
R0554:Myrfl UTSW 10 116828973 missense probably damaging 1.00
R0601:Myrfl UTSW 10 116776760 missense probably damaging 1.00
R0790:Myrfl UTSW 10 116817788 missense probably damaging 0.99
R0831:Myrfl UTSW 10 116783209 missense probably benign 0.06
R0931:Myrfl UTSW 10 116839449 missense probably benign 0.01
R0945:Myrfl UTSW 10 116803394 splice site probably benign
R1078:Myrfl UTSW 10 116776732 missense possibly damaging 0.94
R1187:Myrfl UTSW 10 116831542 missense probably damaging 1.00
R1329:Myrfl UTSW 10 116777342 critical splice donor site probably null
R1432:Myrfl UTSW 10 116777427 missense probably damaging 1.00
R1762:Myrfl UTSW 10 116798593 missense probably damaging 1.00
R1827:Myrfl UTSW 10 116832947 missense probably damaging 0.99
R1952:Myrfl UTSW 10 116822811 missense probably benign 0.00
R2138:Myrfl UTSW 10 116795538 missense probably benign 0.00
R2317:Myrfl UTSW 10 116839384 missense possibly damaging 0.77
R2930:Myrfl UTSW 10 116817747 missense probably damaging 1.00
R3405:Myrfl UTSW 10 116822865 missense probably damaging 1.00
R4118:Myrfl UTSW 10 116828965 missense probably damaging 1.00
R4700:Myrfl UTSW 10 116777342 critical splice donor site probably null
R5039:Myrfl UTSW 10 116822711 missense probably damaging 1.00
R5097:Myrfl UTSW 10 116817704 missense probably damaging 1.00
R5138:Myrfl UTSW 10 116796058 critical splice donor site probably null
R5211:Myrfl UTSW 10 116798630 missense probably benign 0.00
R5249:Myrfl UTSW 10 116783233 missense probably benign
R5573:Myrfl UTSW 10 116822756 missense probably damaging 0.98
R6033:Myrfl UTSW 10 116849101 missense probably benign
R6033:Myrfl UTSW 10 116849101 missense probably benign
R6091:Myrfl UTSW 10 116849206 missense probably benign
R6315:Myrfl UTSW 10 116822819 missense possibly damaging 0.81
R6812:Myrfl UTSW 10 116832913 missense probably damaging 1.00
R6867:Myrfl UTSW 10 116848282 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGGACTTGCTGCAAAGGGAG -3'
(R):5'- GAATGCTACAGCAGCCTCAGACAG -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- GAAGTCTTGCTGGAAAGAGTTATC -3'
Posted On2014-01-29