Incidental Mutation 'V7582:Otop3'
ID152613
Institutional Source Beutler Lab
Gene Symbol Otop3
Ensembl Gene ENSMUSG00000018862
Gene Nameotopetrin 3
Synonyms2310011E08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #V7582 () of strain stinger
Quality Score141
Status Not validated
Chromosome11
Chromosomal Location115334731-115346927 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115344838 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 432 (L432Q)
Ref Sequence ENSEMBL: ENSMUSP00000102153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019006] [ENSMUST00000044152] [ENSMUST00000106542] [ENSMUST00000106543]
Predicted Effect probably damaging
Transcript: ENSMUST00000019006
AA Change: L451Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019006
Gene: ENSMUSG00000018862
AA Change: L451Q

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 102 120 N/A INTRINSIC
Pfam:Otopetrin 142 483 3e-40 PFAM
Pfam:Otopetrin 506 583 1.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044152
SMART Domains Protein: ENSMUSP00000043789
Gene: ENSMUSG00000034586

DomainStartEndE-ValueType
Pfam:Dymeclin 1 763 3.9e-242 PFAM
Pfam:Hid1 1 784 3.1e-260 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106542
SMART Domains Protein: ENSMUSP00000102152
Gene: ENSMUSG00000034586

DomainStartEndE-ValueType
Pfam:Dymeclin 1 764 7.5e-275 PFAM
Pfam:Hid1 1 785 2.3e-261 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106543
AA Change: L432Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102153
Gene: ENSMUSG00000018862
AA Change: L432Q

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 102 120 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 178 195 N/A INTRINSIC
transmembrane domain 208 227 N/A INTRINSIC
Pfam:Otopetrin 241 462 2.1e-20 PFAM
Pfam:Otopetrin 487 564 2.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146256
Meta Mutation Damage Score 0.38 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Ahcy G A 2: 155,064,921 R151* probably null Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fbrsl1 C T 5: 110,379,426 A129T possibly damaging Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Hira G A 16: 18,894,821 A29T probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Med20 G A 17: 47,618,832 V65M probably damaging Het
Myrfl T C 10: 116,861,530 T30A probably damaging Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Rbbp8nl T A 2: 180,278,208 T558S probably benign Het
Rundc3b TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 5: 8,622,549 probably benign Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Thbd A T 2: 148,407,190 Y253N probably benign Het
Tiam1 C T 16: 89,865,271 R653H probably damaging Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Other mutations in Otop3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Otop3 APN 11 115344453 missense probably benign
IGL00159:Otop3 APN 11 115344397 missense probably damaging 1.00
IGL01372:Otop3 APN 11 115345104 missense possibly damaging 0.86
IGL01380:Otop3 APN 11 115346411 missense probably damaging 1.00
IGL01960:Otop3 APN 11 115340969 missense probably damaging 0.97
IGL03099:Otop3 APN 11 115339582 missense probably damaging 0.99
F5770:Otop3 UTSW 11 115344838 missense probably damaging 1.00
R1560:Otop3 UTSW 11 115344463 missense possibly damaging 0.89
R2847:Otop3 UTSW 11 115344558 missense probably damaging 0.99
R2849:Otop3 UTSW 11 115344558 missense probably damaging 0.99
R5582:Otop3 UTSW 11 115339339 missense unknown
R6383:Otop3 UTSW 11 115345072 missense probably damaging 0.99
R6601:Otop3 UTSW 11 115339847 missense probably damaging 0.98
V7580:Otop3 UTSW 11 115344838 missense probably damaging 1.00
V7581:Otop3 UTSW 11 115344838 missense probably damaging 1.00
V7583:Otop3 UTSW 11 115344838 missense probably damaging 1.00
X0022:Otop3 UTSW 11 115339867 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACATAGCCCGCCAGTACTTCAC -3'
(R):5'- ATGAGCTTCTGCCCAGACACTCAC -3'

Sequencing Primer
(F):5'- TGTGCTGCCCACCATGAG -3'
(R):5'- GAGCATCCTGCGTTTCCAG -3'
Posted On2014-01-29