Incidental Mutation 'V7582:Cdc42bpb'
ID152619
Institutional Source Beutler Lab
Gene Symbol Cdc42bpb
Ensembl Gene ENSMUSG00000021279
Gene NameCDC42 binding protein kinase beta
SynonymsDMPK-like
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.560) question?
Stock #V7582 () of strain stinger
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location111292976-111377718 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 111296391 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 1501 (G1501S)
Ref Sequence ENSEMBL: ENSMUSP00000042565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041965] [ENSMUST00000220657]
Predicted Effect probably benign
Transcript: ENSMUST00000041965
AA Change: G1501S

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000042565
Gene: ENSMUSG00000021279
AA Change: G1501S

DomainStartEndE-ValueType
S_TKc 76 342 1e-87 SMART
S_TK_X 343 405 5.02e-10 SMART
Pfam:KELK 527 606 4.5e-32 PFAM
low complexity region 628 640 N/A INTRINSIC
coiled coil region 727 815 N/A INTRINSIC
low complexity region 843 859 N/A INTRINSIC
Pfam:DMPK_coil 878 939 1.2e-29 PFAM
C1 1027 1076 1.43e-11 SMART
PH 1097 1217 1.19e-6 SMART
CNH 1240 1521 1.32e-10 SMART
low complexity region 1564 1576 N/A INTRINSIC
PBD 1585 1620 7.16e-10 SMART
low complexity region 1681 1696 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220619
Predicted Effect probably benign
Transcript: ENSMUST00000220657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222483
Predicted Effect probably benign
Transcript: ENSMUST00000222724
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. The encoded protein contains a Cdc42/Rac-binding p21 binding domain resembling that of PAK kinase. The kinase domain of this protein is most closely related to that of myotonic dystrophy kinase-related ROK. Studies of the similar gene in rat suggested that this kinase may act as a downstream effector of Cdc42 in cytoskeletal reorganization. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Ahcy G A 2: 155,064,921 R151* probably null Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fbrsl1 C T 5: 110,379,426 A129T possibly damaging Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Hira G A 16: 18,894,821 A29T probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Med20 G A 17: 47,618,832 V65M probably damaging Het
Myrfl T C 10: 116,861,530 T30A probably damaging Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Rbbp8nl T A 2: 180,278,208 T558S probably benign Het
Rundc3b TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 5: 8,622,549 probably benign Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Thbd A T 2: 148,407,190 Y253N probably benign Het
Tiam1 C T 16: 89,865,271 R653H probably damaging Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Other mutations in Cdc42bpb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Cdc42bpb APN 12 111294096 unclassified probably benign
IGL01360:Cdc42bpb APN 12 111342075 missense probably damaging 1.00
IGL01577:Cdc42bpb APN 12 111302043 missense possibly damaging 0.71
IGL01909:Cdc42bpb APN 12 111323142 missense probably benign
IGL01924:Cdc42bpb APN 12 111317453 unclassified probably benign
IGL02428:Cdc42bpb APN 12 111323127 missense probably benign
IGL02678:Cdc42bpb APN 12 111326096 missense probably damaging 1.00
IGL02792:Cdc42bpb APN 12 111299561 missense probably benign
IGL03367:Cdc42bpb APN 12 111336159 missense probably damaging 1.00
F5770:Cdc42bpb UTSW 12 111296391 missense probably benign 0.28
R0129:Cdc42bpb UTSW 12 111304959 intron probably benign
R0633:Cdc42bpb UTSW 12 111345555 missense probably damaging 0.99
R1054:Cdc42bpb UTSW 12 111313353 missense probably benign 0.00
R1335:Cdc42bpb UTSW 12 111296441 missense probably damaging 1.00
R1459:Cdc42bpb UTSW 12 111296300 unclassified probably benign
R1780:Cdc42bpb UTSW 12 111322907 missense probably damaging 1.00
R1823:Cdc42bpb UTSW 12 111327559 missense probably damaging 1.00
R1843:Cdc42bpb UTSW 12 111322821 missense probably benign
R1902:Cdc42bpb UTSW 12 111326016 missense probably damaging 1.00
R1945:Cdc42bpb UTSW 12 111299133 missense probably damaging 1.00
R2077:Cdc42bpb UTSW 12 111299196 missense probably damaging 1.00
R2184:Cdc42bpb UTSW 12 111296044 missense probably damaging 0.99
R2208:Cdc42bpb UTSW 12 111336029 missense probably damaging 1.00
R2211:Cdc42bpb UTSW 12 111301854 missense probably benign 0.11
R2273:Cdc42bpb UTSW 12 111302167 missense probably damaging 1.00
R2406:Cdc42bpb UTSW 12 111302124 missense probably benign 0.00
R3080:Cdc42bpb UTSW 12 111295818 missense probably damaging 0.99
R3612:Cdc42bpb UTSW 12 111303822 intron probably benign
R4106:Cdc42bpb UTSW 12 111295145 missense probably benign 0.01
R4133:Cdc42bpb UTSW 12 111321542 missense probably benign 0.00
R4156:Cdc42bpb UTSW 12 111294139 missense probably benign 0.17
R4202:Cdc42bpb UTSW 12 111294139 missense probably benign 0.17
R4573:Cdc42bpb UTSW 12 111323141 missense probably benign 0.00
R4659:Cdc42bpb UTSW 12 111339891 missense probably damaging 1.00
R5101:Cdc42bpb UTSW 12 111299115 missense probably damaging 1.00
R5591:Cdc42bpb UTSW 12 111323087 missense probably benign 0.01
R5669:Cdc42bpb UTSW 12 111302013 critical splice donor site probably null
R5830:Cdc42bpb UTSW 12 111345582 nonsense probably null
R5872:Cdc42bpb UTSW 12 111325976 missense probably damaging 1.00
R6748:Cdc42bpb UTSW 12 111294839 unclassified probably benign
R6813:Cdc42bpb UTSW 12 111327615 missense probably damaging 1.00
V7583:Cdc42bpb UTSW 12 111296391 missense probably benign 0.28
X0023:Cdc42bpb UTSW 12 111326078 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCGGGAACCTTGAAGACAAAAC -3'
(R):5'- TAAAGATGACTTCTGGCACGGGAGC -3'

Sequencing Primer
(F):5'- GAAGACAAAACGTCGTTTGCTC -3'
(R):5'- AGGCAGTGCTATGCACCTC -3'
Posted On2014-01-29