Incidental Mutation 'V7582:Dnajc22'
ID152621
Institutional Source Beutler Lab
Gene Symbol Dnajc22
Ensembl Gene ENSMUSG00000038009
Gene NameDnaJ heat shock protein family (Hsp40) member C22
Synonyms2810451A06Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #V7582 () of strain stinger
Quality Score155
Status Not validated
Chromosome15
Chromosomal Location99093170-99104737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99101482 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 183 (Y183N)
Ref Sequence ENSEMBL: ENSMUSP00000055482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061295]
Predicted Effect probably damaging
Transcript: ENSMUST00000061295
AA Change: Y183N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055482
Gene: ENSMUSG00000038009
AA Change: Y183N

DomainStartEndE-ValueType
Pfam:TM2 1 50 1e-10 PFAM
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 105 124 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 206 228 N/A INTRINSIC
DnaJ 276 335 1.09e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146173
Meta Mutation Damage Score 0.158 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Ahcy G A 2: 155,064,921 R151* probably null Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fbrsl1 C T 5: 110,379,426 A292T possibly damaging Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Hira G A 16: 18,894,821 A29T probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Med20 G A 17: 47,618,832 V65M probably damaging Het
Myrfl T C 10: 116,861,530 T30A probably damaging Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Otop3 T A 11: 115,344,838 L451Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Rbbp8nl T A 2: 180,278,208 T558S probably benign Het
Rundc3b TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 5: 8,622,549 probably benign Het
Slc30a4 T A 2: 122,689,538 M185L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Thbd A T 2: 148,407,190 Y253N probably benign Het
Tiam1 C T 16: 89,865,271 R653H probably damaging Het
Tnrc6c G A 11: 117,723,326 R930H probably damaging Het
Toe1 A T 4: 116,806,111 N122K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Other mutations in Dnajc22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Dnajc22 APN 15 99101178 missense possibly damaging 0.73
IGL00922:Dnajc22 APN 15 99101579 missense possibly damaging 0.89
IGL02155:Dnajc22 APN 15 99101005 missense probably damaging 1.00
IGL02726:Dnajc22 APN 15 99101000 missense probably damaging 1.00
IGL03074:Dnajc22 APN 15 99101522 missense probably damaging 1.00
F5770:Dnajc22 UTSW 15 99101482 missense probably damaging 0.99
R1138:Dnajc22 UTSW 15 99104427 small deletion probably benign
R1628:Dnajc22 UTSW 15 99100936 start codon destroyed probably null 1.00
R2018:Dnajc22 UTSW 15 99101233 missense probably benign 0.06
R2146:Dnajc22 UTSW 15 99104383 missense probably benign 0.04
R4342:Dnajc22 UTSW 15 99104464 nonsense probably null
R4950:Dnajc22 UTSW 15 99101734 missense probably benign 0.29
V7580:Dnajc22 UTSW 15 99101482 missense probably damaging 0.99
V7581:Dnajc22 UTSW 15 99101482 missense probably damaging 0.99
V7583:Dnajc22 UTSW 15 99101482 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGTTGGTAACCAGACCTCAGAC -3'
(R):5'- CCTCATGCAAGCTACAAGCTCCTG -3'

Sequencing Primer
(F):5'- CTTTAAGAATACCTTAGGAGCGGC -3'
(R):5'- TCTCTGAGGAGACTTACCCGAAG -3'
Posted On2014-01-29