Incidental Mutation 'V7582:Hira'
ID152622
Institutional Source Beutler Lab
Gene Symbol Hira
Ensembl Gene ENSMUSG00000022702
Gene Namehistone cell cycle regulator
SynonymsD16Ertd95e, Gm15797, Tuple1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #V7582 () of strain stinger
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location18877037-18970309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 18894821 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 29 (A29T)
Ref Sequence ENSEMBL: ENSMUSP00000155948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004222] [ENSMUST00000120532] [ENSMUST00000128321] [ENSMUST00000144609] [ENSMUST00000153397] [ENSMUST00000190050]
Predicted Effect probably damaging
Transcript: ENSMUST00000004222
AA Change: A29T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004222
Gene: ENSMUSG00000022702
AA Change: A29T

DomainStartEndE-ValueType
WD40 1 44 1.56e-1 SMART
WD40 59 98 9.67e-7 SMART
WD40 120 159 3.58e-10 SMART
WD40 163 202 7.22e-6 SMART
WD40 212 254 9.17e1 SMART
WD40 257 313 1.54e0 SMART
WD40 319 356 2.86e0 SMART
low complexity region 405 412 N/A INTRINSIC
Pfam:HIRA_B 448 470 1.9e-10 PFAM
low complexity region 493 507 N/A INTRINSIC
low complexity region 540 556 N/A INTRINSIC
low complexity region 600 614 N/A INTRINSIC
low complexity region 626 641 N/A INTRINSIC
Pfam:Hira 761 960 2.9e-61 PFAM
low complexity region 979 989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120532
SMART Domains Protein: ENSMUSP00000112614
Gene: ENSMUSG00000022702

DomainStartEndE-ValueType
WD40 15 54 9.67e-7 SMART
WD40 76 115 3.58e-10 SMART
WD40 119 158 7.22e-6 SMART
WD40 168 210 9.17e1 SMART
WD40 213 269 1.54e0 SMART
WD40 275 312 2.86e0 SMART
low complexity region 361 368 N/A INTRINSIC
Pfam:HIRA_B 404 427 1.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000128321
AA Change: A29T

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000144609
AA Change: A29T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000153397
AA Change: A29T

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117944
Gene: ENSMUSG00000022702
AA Change: A29T

DomainStartEndE-ValueType
Blast:WD40 1 40 1e-18 BLAST
SCOP:d1erja_ 7 33 3e-3 SMART
Predicted Effect silent
Transcript: ENSMUST00000190050
SMART Domains Protein: ENSMUSP00000141101
Gene: ENSMUSG00000099908

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
Meta Mutation Damage Score 0.302 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a histone chaperone that preferentially places the variant histone H3.3 in nucleosomes. Orthologs of this gene in yeast, flies, and plants are necessary for the formation of transcriptionally silent heterochomatin. This gene plays an important role in the formation of the senescence-associated heterochromatin foci. These foci likely mediate the irreversible cell cycle changes that occur in senescent cells. It is considered the primary candidate gene in some haploinsufficiency syndromes such as DiGeorge syndrome, and insufficient production of the gene may disrupt normal embryonic development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted gastrulation, malformations of axial and paraxial mesoendoderm, abnormal placentas, failure of cardiac development, and lethality by embryonic day 11. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Ahcy G A 2: 155,064,921 R151* probably null Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fbrsl1 C T 5: 110,379,426 A292T possibly damaging Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Med20 G A 17: 47,618,832 V65M probably damaging Het
Myrfl T C 10: 116,861,530 T30A probably damaging Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Otop3 T A 11: 115,344,838 L451Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Rbbp8nl T A 2: 180,278,208 T558S probably benign Het
Rundc3b TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 5: 8,622,549 probably benign Het
Slc30a4 T A 2: 122,689,538 M185L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Thbd A T 2: 148,407,190 Y253N probably benign Het
Tiam1 C T 16: 89,865,271 R653H probably damaging Het
Tnrc6c G A 11: 117,723,326 R930H probably damaging Het
Toe1 A T 4: 116,806,111 N122K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Other mutations in Hira
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00560:Hira APN 16 18946340 unclassified probably benign
IGL01285:Hira APN 16 18912180 missense probably benign 0.01
F5770:Hira UTSW 16 18894821 missense probably damaging 1.00
IGL02796:Hira UTSW 16 18925654 missense probably benign 0.01
R0123:Hira UTSW 16 18956171 missense probably benign 0.45
R0225:Hira UTSW 16 18956171 missense probably benign 0.45
R0606:Hira UTSW 16 18935047 missense probably benign 0.00
R1017:Hira UTSW 16 18899347 intron probably null
R1456:Hira UTSW 16 18925663 missense probably benign 0.02
R1479:Hira UTSW 16 18896469 missense probably damaging 1.00
R1731:Hira UTSW 16 18933014 missense probably benign 0.01
R1830:Hira UTSW 16 18947414 missense probably damaging 1.00
R2039:Hira UTSW 16 18951701 missense probably benign 0.05
R4328:Hira UTSW 16 18896612 intron probably benign 0.01
R4401:Hira UTSW 16 18925720 missense probably damaging 1.00
R4423:Hira UTSW 16 18956202 missense possibly damaging 0.80
R4634:Hira UTSW 16 18946400 missense probably damaging 0.98
R4728:Hira UTSW 16 18922904 missense probably damaging 1.00
R5050:Hira UTSW 16 18925859 missense possibly damaging 0.75
R5139:Hira UTSW 16 18954758 missense probably damaging 1.00
R5201:Hira UTSW 16 18952115 missense probably damaging 0.98
R5327:Hira UTSW 16 18954758 missense probably damaging 1.00
R5483:Hira UTSW 16 18969540 missense possibly damaging 0.89
R5573:Hira UTSW 16 18916599 missense probably damaging 1.00
R5626:Hira UTSW 16 18927512 missense probably damaging 0.97
R5768:Hira UTSW 16 18935018 missense probably benign
R5952:Hira UTSW 16 18935065 missense possibly damaging 0.83
R6128:Hira UTSW 16 18932977 missense probably benign 0.08
R6280:Hira UTSW 16 18910707 missense probably damaging 1.00
V7581:Hira UTSW 16 18894821 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGTACCCAGCAATGCTGTAGTC -3'
(R):5'- GAATCCTTGCCTCTCTGTAACTGGAC -3'

Sequencing Primer
(F):5'- CAGCAATGCTGTAGTCTCTTG -3'
(R):5'- CCATGGATCCAAAAGAAGCAG -3'
Posted On2014-01-29