Incidental Mutation 'V7582:Tiam1'
ID152623
Institutional Source Beutler Lab
Gene Symbol Tiam1
Ensembl Gene ENSMUSG00000002489
Gene NameT cell lymphoma invasion and metastasis 1
SynonymsD16Ium10e, D16Ium10
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #V7582 () of strain stinger
Quality Score139
Status Not validated
Chromosome16
Chromosomal Location89787111-90143769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89865271 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 653 (R653H)
Ref Sequence ENSEMBL: ENSMUSP00000109759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002588] [ENSMUST00000114124] [ENSMUST00000163370]
Predicted Effect probably damaging
Transcript: ENSMUST00000002588
AA Change: R653H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002588
Gene: ENSMUSG00000002489
AA Change: R653H

DomainStartEndE-ValueType
low complexity region 52 67 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
PH 434 549 1.32e-13 SMART
low complexity region 573 586 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
RBD 765 832 1.76e-22 SMART
PDZ 856 928 1.15e-5 SMART
low complexity region 1013 1028 N/A INTRINSIC
RhoGEF 1044 1233 1.42e-63 SMART
PH 1262 1397 9.58e-2 SMART
low complexity region 1445 1454 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114124
AA Change: R653H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109759
Gene: ENSMUSG00000002489
AA Change: R653H

DomainStartEndE-ValueType
low complexity region 52 67 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
PH 434 549 1.32e-13 SMART
low complexity region 573 586 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
RBD 765 832 1.76e-22 SMART
PDZ 856 928 1.15e-5 SMART
low complexity region 1013 1028 N/A INTRINSIC
RhoGEF 1044 1233 1.42e-63 SMART
PH 1262 1397 9.58e-2 SMART
low complexity region 1445 1454 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163370
AA Change: R653H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132137
Gene: ENSMUSG00000002489
AA Change: R653H

DomainStartEndE-ValueType
low complexity region 52 67 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
PH 434 549 1.32e-13 SMART
low complexity region 573 586 N/A INTRINSIC
low complexity region 683 695 N/A INTRINSIC
RBD 765 832 1.76e-22 SMART
PDZ 856 928 1.15e-5 SMART
low complexity region 1013 1028 N/A INTRINSIC
RhoGEF 1044 1233 1.42e-63 SMART
PH 1262 1397 9.58e-2 SMART
low complexity region 1445 1454 N/A INTRINSIC
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null allele display resistance to chemically-induced tumors, however, tumors that do develop progress to malignancy. Mice homozygous for a gene trap allele display anencephaly, exencephaly and/or neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Ahcy G A 2: 155,064,921 R151* probably null Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fbrsl1 C T 5: 110,379,426 A292T possibly damaging Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Hira G A 16: 18,894,821 A29T probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Med20 G A 17: 47,618,832 V65M probably damaging Het
Myrfl T C 10: 116,861,530 T30A probably damaging Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Otop3 T A 11: 115,344,838 L451Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Rbbp8nl T A 2: 180,278,208 T558S probably benign Het
Rundc3b TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 5: 8,622,549 probably benign Het
Slc30a4 T A 2: 122,689,538 M185L probably benign Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Thbd A T 2: 148,407,190 Y253N probably benign Het
Tnrc6c G A 11: 117,723,326 R930H probably damaging Het
Toe1 A T 4: 116,806,111 N122K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Other mutations in Tiam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Tiam1 APN 16 89794739 missense probably damaging 1.00
IGL01356:Tiam1 APN 16 89837788 missense probably damaging 0.99
IGL01583:Tiam1 APN 16 89789280 missense probably damaging 1.00
IGL01626:Tiam1 APN 16 89812968 missense probably damaging 1.00
IGL01802:Tiam1 APN 16 89898372 missense possibly damaging 0.94
IGL01818:Tiam1 APN 16 89867704 missense probably damaging 1.00
IGL02146:Tiam1 APN 16 89849681 missense probably benign 0.20
IGL02329:Tiam1 APN 16 89800036 missense probably benign 0.08
IGL02341:Tiam1 APN 16 89898369 missense probably damaging 1.00
IGL02622:Tiam1 APN 16 89798700 missense possibly damaging 0.59
F5770:Tiam1 UTSW 16 89865271 missense probably damaging 1.00
R0130:Tiam1 UTSW 16 89897754 missense probably benign 0.01
R0143:Tiam1 UTSW 16 89898200 missense probably benign 0.01
R0158:Tiam1 UTSW 16 89793001 missense probably null
R0413:Tiam1 UTSW 16 89809365 splice site probably benign
R0449:Tiam1 UTSW 16 89837827 missense possibly damaging 0.75
R0520:Tiam1 UTSW 16 89817951 splice site probably benign
R0667:Tiam1 UTSW 16 89897984 missense probably damaging 1.00
R0787:Tiam1 UTSW 16 89789561 missense probably damaging 1.00
R1355:Tiam1 UTSW 16 89898221 missense probably benign 0.09
R1370:Tiam1 UTSW 16 89898221 missense probably benign 0.09
R1534:Tiam1 UTSW 16 89867508 critical splice donor site probably null
R1769:Tiam1 UTSW 16 89860279 missense probably damaging 1.00
R1831:Tiam1 UTSW 16 89860294 missense probably benign 0.01
R1913:Tiam1 UTSW 16 89798694 missense probably damaging 1.00
R2022:Tiam1 UTSW 16 89877187 missense probably benign
R2140:Tiam1 UTSW 16 89849645 splice site probably benign
R2383:Tiam1 UTSW 16 89798684 missense probably benign 0.29
R2697:Tiam1 UTSW 16 89793164 missense probably benign 0.00
R4118:Tiam1 UTSW 16 89877033 splice site probably null
R4327:Tiam1 UTSW 16 89855891 missense possibly damaging 0.80
R4693:Tiam1 UTSW 16 89843282 missense possibly damaging 0.87
R5104:Tiam1 UTSW 16 89818041 missense probably benign 0.00
R5412:Tiam1 UTSW 16 89884865 missense possibly damaging 0.52
R5426:Tiam1 UTSW 16 89865392 missense possibly damaging 0.58
R5600:Tiam1 UTSW 16 89865365 missense probably damaging 1.00
R5842:Tiam1 UTSW 16 89855999 missense probably benign
R5986:Tiam1 UTSW 16 89789186 missense probably benign 0.31
R6077:Tiam1 UTSW 16 89798030 critical splice donor site probably null
R6417:Tiam1 UTSW 16 89898024 nonsense probably null
R6525:Tiam1 UTSW 16 89858597 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCATGACCTGCCAAGTGAAGC -3'
(R):5'- GATCTGCAAGGCTCTTGGAGAAGAC -3'

Sequencing Primer
(F):5'- CTGCCAAGTGAAGCCTTTTTG -3'
(R):5'- CTGTTCCGATTCCGCTGTTA -3'
Posted On2014-01-29