Incidental Mutation 'R1081:Cntnap5c'
ID152724
Institutional Source Beutler Lab
Gene Symbol Cntnap5c
Ensembl Gene ENSMUSG00000038048
Gene Namecontactin associated protein-like 5C
Synonyms
MMRRC Submission 039167-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R1081 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location57769570-58410355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58305525 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 853 (D853G)
Ref Sequence ENSEMBL: ENSMUSP00000075416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076038]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076038
AA Change: D853G

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000075416
Gene: ENSMUSG00000038048
AA Change: D853G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FA58C 29 174 1.26e-10 SMART
LamG 201 338 1.57e-29 SMART
LamG 387 521 3e-26 SMART
EGF 549 583 1.88e-1 SMART
Blast:FBG 586 769 8e-83 BLAST
LamG 811 938 4.37e-28 SMART
EGF 959 995 6.55e-1 SMART
LamG 1036 1172 2.08e-11 SMART
transmembrane domain 1240 1262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,162,020 E309G probably benign Het
Abr T C 11: 76,455,615 K448E probably damaging Het
Atxn2l T C 7: 126,494,212 Y785C probably damaging Het
Atxn3 T G 12: 101,934,349 D225A probably damaging Het
BC049730 T C 7: 24,713,542 probably null Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Dnah9 A G 11: 66,084,877 Y1449H probably damaging Het
Dsc2 T G 18: 20,033,295 T760P probably damaging Het
Dync2h1 A T 9: 7,005,488 probably null Het
Epg5 T C 18: 77,959,533 F611L possibly damaging Het
Fat3 T C 9: 16,375,284 D981G possibly damaging Het
Gimap3 A T 6: 48,765,152 C281* probably null Het
Ids T C X: 70,361,110 D149G possibly damaging Het
Inpp4b A G 8: 82,069,024 I826V probably damaging Het
Kcnrg C A 14: 61,607,714 H68N possibly damaging Het
Klra6 A G 6: 130,022,625 Y127H probably damaging Het
Mepce A G 5: 137,784,696 L456P probably damaging Het
Mink1 T C 11: 70,607,035 L488P probably benign Het
Mndal T A 1: 173,860,222 E482V probably benign Het
Mob1b G A 5: 88,753,162 V143I probably benign Het
Msh4 T C 3: 153,872,358 E433G probably benign Het
Myof A T 19: 37,986,088 I201N probably damaging Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ntsr1 G A 2: 180,538,756 S285N probably benign Het
Olfr319 C T 11: 58,702,498 H266Y probably damaging Het
Olfr598 A G 7: 103,329,038 Y184C probably damaging Het
Olfr66 T A 7: 103,882,177 H22L possibly damaging Het
Olfr730 A G 14: 50,187,197 S7P probably damaging Het
P2rx4 A G 5: 122,727,233 E307G probably damaging Het
Pcdh15 A G 10: 74,450,313 D793G probably damaging Het
Rpap1 G A 2: 119,771,269 R737W probably damaging Het
Rpusd4 A G 9: 35,275,088 K307E probably benign Het
Shtn1 T A 19: 58,975,015 T623S probably benign Het
Sntg1 A G 1: 8,445,119 C397R possibly damaging Het
Stat5a T C 11: 100,881,060 F646S probably damaging Het
Tacc2 A G 7: 130,728,574 E196G possibly damaging Het
Tcf25 T C 8: 123,381,473 V89A probably benign Het
Trim7 G T 11: 48,849,705 V210L probably damaging Het
Vmn2r57 A G 7: 41,428,211 M177T possibly damaging Het
Wwc2 G A 8: 47,828,764 probably benign Het
Zfp28 A G 7: 6,389,780 I152V possibly damaging Het
Zfp628 A G 7: 4,920,183 H468R probably damaging Het
Zfp770 A G 2: 114,197,127 Y154H probably damaging Het
Other mutations in Cntnap5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Cntnap5c APN 17 58162277 missense probably benign 0.00
IGL00543:Cntnap5c APN 17 58294350 missense probably benign
IGL00679:Cntnap5c APN 17 58055678 missense probably damaging 0.98
IGL00942:Cntnap5c APN 17 57769598 missense probably benign 0.03
IGL01352:Cntnap5c APN 17 58293901 missense probably benign 0.00
IGL01822:Cntnap5c APN 17 58055705 missense probably damaging 0.99
IGL01864:Cntnap5c APN 17 58410242 missense probably benign
IGL01922:Cntnap5c APN 17 58330119 missense possibly damaging 0.95
IGL02111:Cntnap5c APN 17 58102108 missense probably damaging 1.00
IGL02112:Cntnap5c APN 17 58313858 missense probably benign 0.00
IGL02259:Cntnap5c APN 17 58034862 missense probably damaging 0.98
IGL02270:Cntnap5c APN 17 58034853 missense probably benign 0.08
IGL02312:Cntnap5c APN 17 58138699 missense probably benign 0.09
IGL02456:Cntnap5c APN 17 58407744 splice site probably benign
IGL02755:Cntnap5c APN 17 58364194 missense probably benign 0.02
IGL02955:Cntnap5c APN 17 57892102 splice site probably benign
IGL03001:Cntnap5c APN 17 58055639 missense probably damaging 1.00
IGL03012:Cntnap5c APN 17 58359234 missense probably benign 0.01
IGL03243:Cntnap5c APN 17 58102176 missense probably benign 0.01
IGL03375:Cntnap5c APN 17 58162205 missense possibly damaging 0.94
IGL02802:Cntnap5c UTSW 17 58305684 missense probably benign 0.04
LCD18:Cntnap5c UTSW 17 58162160 intron probably benign
R0003:Cntnap5c UTSW 17 58199017 missense probably benign
R0041:Cntnap5c UTSW 17 57876469 missense probably benign 0.00
R0041:Cntnap5c UTSW 17 57876469 missense probably benign 0.00
R0046:Cntnap5c UTSW 17 58359300 missense probably benign
R0046:Cntnap5c UTSW 17 58359300 missense probably benign
R0179:Cntnap5c UTSW 17 57769625 missense probably benign 0.19
R0244:Cntnap5c UTSW 17 58102168 missense probably damaging 1.00
R0445:Cntnap5c UTSW 17 58104743 missense probably benign 0.01
R0626:Cntnap5c UTSW 17 58042427 missense probably benign 0.29
R0675:Cntnap5c UTSW 17 58034995 missense probably damaging 1.00
R0681:Cntnap5c UTSW 17 58305555 missense possibly damaging 0.91
R0699:Cntnap5c UTSW 17 58042498 missense probably damaging 1.00
R0927:Cntnap5c UTSW 17 58042558 missense possibly damaging 0.78
R1132:Cntnap5c UTSW 17 58294356 missense probably damaging 1.00
R1175:Cntnap5c UTSW 17 58364246 missense possibly damaging 0.51
R1640:Cntnap5c UTSW 17 58395294 missense probably benign 0.01
R1664:Cntnap5c UTSW 17 58293990 missense probably benign 0.00
R1758:Cntnap5c UTSW 17 58042550 missense probably damaging 1.00
R1785:Cntnap5c UTSW 17 58162291 missense probably benign 0.00
R1789:Cntnap5c UTSW 17 58013921 missense probably damaging 1.00
R1968:Cntnap5c UTSW 17 58359296 missense probably damaging 1.00
R2041:Cntnap5c UTSW 17 58104770 critical splice donor site probably null
R2041:Cntnap5c UTSW 17 58198989 missense probably benign 0.02
R2073:Cntnap5c UTSW 17 58305552 missense possibly damaging 0.58
R2093:Cntnap5c UTSW 17 58199000 missense probably benign 0.00
R2134:Cntnap5c UTSW 17 58407722 missense probably damaging 1.00
R2153:Cntnap5c UTSW 17 58055671 missense possibly damaging 0.90
R2176:Cntnap5c UTSW 17 58013946 missense probably benign 0.04
R2256:Cntnap5c UTSW 17 58330315 missense probably benign 0.00
R2847:Cntnap5c UTSW 17 57876392 missense probably damaging 0.99
R2848:Cntnap5c UTSW 17 57876392 missense probably damaging 0.99
R2850:Cntnap5c UTSW 17 58410348 utr 3 prime probably benign
R3008:Cntnap5c UTSW 17 58359209 missense probably damaging 1.00
R3714:Cntnap5c UTSW 17 57892067 nonsense probably null
R3720:Cntnap5c UTSW 17 58330202 missense probably benign
R3755:Cntnap5c UTSW 17 58104599 missense possibly damaging 0.82
R4001:Cntnap5c UTSW 17 58407740 critical splice donor site probably null
R4619:Cntnap5c UTSW 17 58410268 missense probably benign
R5146:Cntnap5c UTSW 17 58013847 missense probably damaging 0.96
R5309:Cntnap5c UTSW 17 58359254 missense probably benign 0.05
R5312:Cntnap5c UTSW 17 58359254 missense probably benign 0.05
R5722:Cntnap5c UTSW 17 58313857 missense probably benign 0.01
R5974:Cntnap5c UTSW 17 57876485 missense probably benign 0.00
R6017:Cntnap5c UTSW 17 58104698 missense probably benign 0.41
R6059:Cntnap5c UTSW 17 58313712 missense probably damaging 0.99
R6152:Cntnap5c UTSW 17 58286886 missense possibly damaging 0.65
R6182:Cntnap5c UTSW 17 57876395 missense probably benign 0.00
R6298:Cntnap5c UTSW 17 58104752 missense probably damaging 1.00
R6301:Cntnap5c UTSW 17 57892037 missense probably benign 0.01
R6514:Cntnap5c UTSW 17 58330170 missense probably damaging 0.96
R6583:Cntnap5c UTSW 17 58330277 missense probably damaging 1.00
R6688:Cntnap5c UTSW 17 58293904 missense possibly damaging 0.71
R6781:Cntnap5c UTSW 17 58138653 nonsense probably null
R6866:Cntnap5c UTSW 17 58092294 missense probably benign
R6906:Cntnap5c UTSW 17 58395307 missense probably benign 0.18
R6911:Cntnap5c UTSW 17 57892014 missense probably damaging 1.00
R6919:Cntnap5c UTSW 17 58293953 missense probably benign 0.02
R6923:Cntnap5c UTSW 17 58092350 missense possibly damaging 0.96
R6925:Cntnap5c UTSW 17 58395266 missense probably benign 0.39
R6982:Cntnap5c UTSW 17 58092252 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GGTACAATCACAGTAGCTCAAGGAACC -3'
(R):5'- AGCTGAAATTGGAAATGGCCTTCCTC -3'

Sequencing Primer
(F):5'- CTCCAGACAGGCAGAGATGC -3'
(R):5'- TCAGCCCGGATATAATGCCA -3'
Posted On2014-01-29