Incidental Mutation 'R1222:Nr4a2'
ID152736
Institutional Source Beutler Lab
Gene Symbol Nr4a2
Ensembl Gene ENSMUSG00000026826
Gene Namenuclear receptor subfamily 4, group A, member 2
SynonymsRNR-1, HZF-3, Nurr1
MMRRC Submission 039291-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1222 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location57106830-57124003 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57108324 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 543 (N543K)
Ref Sequence ENSEMBL: ENSMUSP00000108248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028166] [ENSMUST00000112627] [ENSMUST00000112629] [ENSMUST00000183542]
Predicted Effect probably damaging
Transcript: ENSMUST00000028166
AA Change: N543K

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028166
Gene: ENSMUSG00000026826
AA Change: N543K

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 124 134 N/A INTRINSIC
ZnF_C4 260 331 2.45e-39 SMART
low complexity region 346 363 N/A INTRINSIC
HOLI 408 566 1.03e-32 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112627
AA Change: N480K

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108246
Gene: ENSMUSG00000026826
AA Change: N480K

DomainStartEndE-ValueType
low complexity region 61 71 N/A INTRINSIC
ZnF_C4 197 268 2.45e-39 SMART
low complexity region 283 300 N/A INTRINSIC
HOLI 345 503 1.03e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112629
AA Change: N543K

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108248
Gene: ENSMUSG00000026826
AA Change: N543K

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 124 134 N/A INTRINSIC
ZnF_C4 260 331 2.45e-39 SMART
low complexity region 346 363 N/A INTRINSIC
HOLI 408 566 1.03e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140165
Predicted Effect probably benign
Transcript: ENSMUST00000183542
SMART Domains Protein: ENSMUSP00000138824
Gene: ENSMUSG00000026826

DomainStartEndE-ValueType
low complexity region 61 71 N/A INTRINSIC
ZnF_C4 197 268 2.45e-39 SMART
low complexity region 283 300 N/A INTRINSIC
Pfam:Hormone_recep 322 392 9.1e-8 PFAM
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the steroid-thyroid hormone-retinoid receptor superfamily. The encoded protein may act as a transcription factor. Mutations in this gene have been associated with disorders related to dopaminergic dysfunction, including Parkinson disease, schizophernia, and manic depression. Misregulation of this gene may be associated with rheumatoid arthritis. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene fail to develop dopaminergic neurons in the mesencephalon and die within the first 12 hours of life. Heterozygotes suffer from reduced motor performance in old age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,145,064 probably benign Het
Abl1 T C 2: 31,800,994 S842P probably benign Het
Agrn C A 4: 156,177,385 V483L probably damaging Het
Ankrd13a T A 5: 114,800,763 C365* probably null Het
Ap2b1 T C 11: 83,346,738 S543P probably benign Het
Atic C T 1: 71,559,279 T67I probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cux1 C T 5: 136,275,149 R1391Q probably benign Het
Cyp2a4 T C 7: 26,308,588 V140A possibly damaging Het
Dlgap3 A T 4: 127,194,613 M1L probably null Het
Dnah3 T C 7: 120,090,676 D2G probably benign Het
Erbb3 A C 10: 128,571,665 V938G probably damaging Het
Fam13a C T 6: 58,935,722 probably benign Het
Gata2 G A 6: 88,200,341 V118I probably benign Het
Gm2663 T C 6: 40,996,041 I211V probably benign Het
Gm5096 A G 18: 87,757,334 K327R probably damaging Het
Gm8298 T A 3: 59,877,261 L385* probably null Het
Izumo3 T A 4: 92,145,047 N104I probably damaging Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Mctp2 T A 7: 72,259,139 H142L probably benign Het
Mmp10 T C 9: 7,505,681 probably benign Het
Mroh8 G A 2: 157,241,854 probably benign Het
Mylk T C 16: 34,860,652 V94A probably benign Het
Nol6 A T 4: 41,120,760 N396K probably benign Het
Nynrin T C 14: 55,863,541 S263P probably benign Het
Olfr1115 G T 2: 87,252,422 G162C probably benign Het
Olfr395 A T 11: 73,907,414 L26H probably damaging Het
Olfr493 T A 7: 108,346,106 I292F probably damaging Het
Olfr77 G A 9: 19,921,048 V280I possibly damaging Het
Pkhd1 T A 1: 20,567,456 R368S probably benign Het
Plekhg4 G A 8: 105,379,110 A736T probably benign Het
Plxna2 A G 1: 194,800,649 D1550G probably damaging Het
Qrfpr C A 3: 36,180,095 G366W probably damaging Het
Qser1 C A 2: 104,777,431 A1471S probably damaging Het
Rars A T 11: 35,809,740 Y505N probably damaging Het
Reln T A 5: 21,986,955 T1496S probably null Het
Rrs1 T C 1: 9,545,855 L111P probably benign Het
Selplg C T 5: 113,819,373 V291M possibly damaging Het
Serpinb1c T A 13: 32,896,951 T50S possibly damaging Het
Slc4a5 A G 6: 83,280,132 K640E probably damaging Het
Szt2 A T 4: 118,405,459 H40Q possibly damaging Het
Taar4 C T 10: 23,961,332 T280I probably benign Het
Tdo2 A G 3: 81,961,468 probably null Het
Tpp1 T C 7: 105,746,741 N527S probably benign Het
Trim43c A T 9: 88,843,078 T218S possibly damaging Het
Trim45 G T 3: 100,927,298 M432I probably benign Het
Ubr4 T C 4: 139,388,471 probably null Het
Vat1l T C 8: 114,282,361 probably benign Het
Xpo7 A T 14: 70,667,084 H1037Q possibly damaging Het
Zmiz1 T C 14: 25,658,096 probably benign Het
Other mutations in Nr4a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Nr4a2 APN 2 57109217 missense probably damaging 1.00
IGL01148:Nr4a2 APN 2 57111971 missense probably benign 0.00
IGL01395:Nr4a2 APN 2 57112153 missense probably damaging 0.98
IGL02123:Nr4a2 APN 2 57111655 missense possibly damaging 0.95
IGL02311:Nr4a2 APN 2 57111731 missense probably benign
IGL02698:Nr4a2 APN 2 57108160 missense probably damaging 1.00
IGL03178:Nr4a2 APN 2 57110766 missense probably damaging 1.00
IGL03261:Nr4a2 APN 2 57110187 missense probably benign 0.40
R0025:Nr4a2 UTSW 2 57108615 missense probably benign 0.14
R0078:Nr4a2 UTSW 2 57112228 missense probably damaging 1.00
R1138:Nr4a2 UTSW 2 57112379 missense probably damaging 0.96
R1418:Nr4a2 UTSW 2 57108324 missense probably damaging 0.97
R1755:Nr4a2 UTSW 2 57109092 missense probably damaging 1.00
R2265:Nr4a2 UTSW 2 57112006 missense possibly damaging 0.77
R2266:Nr4a2 UTSW 2 57112006 missense possibly damaging 0.77
R2267:Nr4a2 UTSW 2 57112006 missense possibly damaging 0.77
R2281:Nr4a2 UTSW 2 57112199 missense probably benign 0.00
R4191:Nr4a2 UTSW 2 57112379 missense probably damaging 0.96
R4706:Nr4a2 UTSW 2 57112213 missense probably damaging 1.00
R4707:Nr4a2 UTSW 2 57112093 missense probably benign 0.17
R4745:Nr4a2 UTSW 2 57110151 missense probably damaging 1.00
R4924:Nr4a2 UTSW 2 57112023 missense probably benign 0.00
R5350:Nr4a2 UTSW 2 57111865 missense probably damaging 0.98
R5495:Nr4a2 UTSW 2 57112375 missense probably damaging 1.00
R6139:Nr4a2 UTSW 2 57108689 missense probably damaging 0.98
R6156:Nr4a2 UTSW 2 57112352 missense probably damaging 1.00
R6325:Nr4a2 UTSW 2 57112418 missense probably damaging 1.00
R6674:Nr4a2 UTSW 2 57112424 missense probably damaging 1.00
R6786:Nr4a2 UTSW 2 57111908 missense probably benign 0.29
R6968:Nr4a2 UTSW 2 57108746 splice site probably null
R7135:Nr4a2 UTSW 2 57112249 missense possibly damaging 0.80
R7256:Nr4a2 UTSW 2 57112369 missense probably damaging 1.00
Z1088:Nr4a2 UTSW 2 57111614 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGTTTTCTAAATCCAGGATGCCCC -3'
(R):5'- AGTACTGCTGGTGCAGGACACTTC -3'

Sequencing Primer
(F):5'- GTGgtttgtttgtttgtttgtttAC -3'
(R):5'- GAACTTCCTCTGGTGGGAC -3'
Posted On2014-01-29