Incidental Mutation 'R1222:Qser1'
ID152738
Institutional Source Beutler Lab
Gene Symbol Qser1
Ensembl Gene ENSMUSG00000074994
Gene Nameglutamine and serine rich 1
Synonyms4732486I23Rik
MMRRC Submission 039291-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R1222 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location104754795-104816760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 104777431 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 1471 (A1471S)
Ref Sequence ENSEMBL: ENSMUSP00000155882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117237] [ENSMUST00000231375]
Predicted Effect probably damaging
Transcript: ENSMUST00000117237
AA Change: A1381S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114062
Gene: ENSMUSG00000074994
AA Change: A1381S

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
low complexity region 196 209 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
low complexity region 532 550 N/A INTRINSIC
low complexity region 697 713 N/A INTRINSIC
low complexity region 1037 1050 N/A INTRINSIC
low complexity region 1420 1449 N/A INTRINSIC
Pfam:DUF4211 1470 1616 1e-26 PFAM
low complexity region 1631 1647 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231375
AA Change: A1471S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.326 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,145,064 probably benign Het
Abl1 T C 2: 31,800,994 S842P probably benign Het
Agrn C A 4: 156,177,385 V483L probably damaging Het
Ankrd13a T A 5: 114,800,763 C365* probably null Het
Ap2b1 T C 11: 83,346,738 S543P probably benign Het
Atic C T 1: 71,559,279 T67I probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cux1 C T 5: 136,275,149 R1391Q probably benign Het
Cyp2a4 T C 7: 26,308,588 V140A possibly damaging Het
Dlgap3 A T 4: 127,194,613 M1L probably null Het
Dnah3 T C 7: 120,090,676 D2G probably benign Het
Erbb3 A C 10: 128,571,665 V938G probably damaging Het
Fam13a C T 6: 58,935,722 probably benign Het
Gata2 G A 6: 88,200,341 V118I probably benign Het
Gm2663 T C 6: 40,996,041 I211V probably benign Het
Gm5096 A G 18: 87,757,334 K327R probably damaging Het
Gm8298 T A 3: 59,877,261 L385* probably null Het
Izumo3 T A 4: 92,145,047 N104I probably damaging Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Mctp2 T A 7: 72,259,139 H142L probably benign Het
Mmp10 T C 9: 7,505,681 probably benign Het
Mroh8 G A 2: 157,241,854 probably benign Het
Mylk T C 16: 34,860,652 V94A probably benign Het
Nol6 A T 4: 41,120,760 N396K probably benign Het
Nr4a2 A T 2: 57,108,324 N543K probably damaging Het
Nynrin T C 14: 55,863,541 S263P probably benign Het
Olfr1115 G T 2: 87,252,422 G162C probably benign Het
Olfr395 A T 11: 73,907,414 L26H probably damaging Het
Olfr493 T A 7: 108,346,106 I292F probably damaging Het
Olfr77 G A 9: 19,921,048 V280I possibly damaging Het
Pkhd1 T A 1: 20,567,456 R368S probably benign Het
Plekhg4 G A 8: 105,379,110 A736T probably benign Het
Plxna2 A G 1: 194,800,649 D1550G probably damaging Het
Qrfpr C A 3: 36,180,095 G366W probably damaging Het
Rars A T 11: 35,809,740 Y505N probably damaging Het
Reln T A 5: 21,986,955 T1496S probably null Het
Rrs1 T C 1: 9,545,855 L111P probably benign Het
Selplg C T 5: 113,819,373 V291M possibly damaging Het
Serpinb1c T A 13: 32,896,951 T50S possibly damaging Het
Slc4a5 A G 6: 83,280,132 K640E probably damaging Het
Szt2 A T 4: 118,405,459 H40Q possibly damaging Het
Taar4 C T 10: 23,961,332 T280I probably benign Het
Tdo2 A G 3: 81,961,468 probably null Het
Tpp1 T C 7: 105,746,741 N527S probably benign Het
Trim43c A T 9: 88,843,078 T218S possibly damaging Het
Trim45 G T 3: 100,927,298 M432I probably benign Het
Ubr4 T C 4: 139,388,471 probably null Het
Vat1l T C 8: 114,282,361 probably benign Het
Xpo7 A T 14: 70,667,084 H1037Q possibly damaging Het
Zmiz1 T C 14: 25,658,096 probably benign Het
Other mutations in Qser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Qser1 APN 2 104766056 missense probably damaging 1.00
IGL00402:Qser1 APN 2 104786981 missense probably benign 0.00
IGL00417:Qser1 APN 2 104786903 missense probably damaging 1.00
IGL00756:Qser1 APN 2 104787671 missense possibly damaging 0.55
IGL01304:Qser1 APN 2 104787631 missense probably damaging 0.99
IGL01317:Qser1 APN 2 104786979 missense probably damaging 0.99
IGL02186:Qser1 APN 2 104788261 missense probably damaging 1.00
IGL03236:Qser1 APN 2 104786532 missense probably benign 0.35
IGL03365:Qser1 APN 2 104786999 missense probably damaging 1.00
behoove UTSW 2 104786977 nonsense probably null
I1329:Qser1 UTSW 2 104786977 nonsense probably null
R0270:Qser1 UTSW 2 104788961 missense probably benign 0.03
R0395:Qser1 UTSW 2 104762881 missense probably damaging 1.00
R0523:Qser1 UTSW 2 104789676 missense probably damaging 1.00
R0727:Qser1 UTSW 2 104777311 splice site probably benign
R1037:Qser1 UTSW 2 104760555 missense probably damaging 0.99
R1418:Qser1 UTSW 2 104777431 missense probably damaging 1.00
R1891:Qser1 UTSW 2 104790099 missense probably benign
R1974:Qser1 UTSW 2 104760541 missense probably damaging 1.00
R2200:Qser1 UTSW 2 104789013 missense probably damaging 1.00
R4179:Qser1 UTSW 2 104776384 missense probably benign 0.19
R4379:Qser1 UTSW 2 104766059 splice site probably null
R4418:Qser1 UTSW 2 104789421 missense probably damaging 1.00
R4585:Qser1 UTSW 2 104786793 missense probably benign 0.01
R4697:Qser1 UTSW 2 104787183 missense probably benign 0.00
R4749:Qser1 UTSW 2 104787304 missense probably benign 0.16
R4775:Qser1 UTSW 2 104789901 missense probably damaging 1.00
R5010:Qser1 UTSW 2 104787831 missense possibly damaging 0.67
R5070:Qser1 UTSW 2 104787282 missense possibly damaging 0.49
R5268:Qser1 UTSW 2 104787431 missense possibly damaging 0.47
R5384:Qser1 UTSW 2 104786642 missense probably damaging 1.00
R5400:Qser1 UTSW 2 104789874 missense probably damaging 1.00
R5502:Qser1 UTSW 2 104786574 missense probably benign 0.00
R5615:Qser1 UTSW 2 104789694 missense possibly damaging 0.78
R5664:Qser1 UTSW 2 104778196 missense probably damaging 1.00
R5750:Qser1 UTSW 2 104788923 missense probably damaging 1.00
R5793:Qser1 UTSW 2 104762860 missense probably damaging 1.00
R6035:Qser1 UTSW 2 104787123 missense probably damaging 0.99
R6035:Qser1 UTSW 2 104787123 missense probably damaging 0.99
R6171:Qser1 UTSW 2 104789283 missense probably damaging 1.00
R6223:Qser1 UTSW 2 104787648 missense probably benign 0.01
R6254:Qser1 UTSW 2 104790090 missense probably benign 0.07
R6303:Qser1 UTSW 2 104762830 missense probably damaging 1.00
R6653:Qser1 UTSW 2 104780260 missense possibly damaging 0.85
R6703:Qser1 UTSW 2 104777325 missense possibly damaging 0.50
R6970:Qser1 UTSW 2 104788130 missense probably benign 0.25
T0722:Qser1 UTSW 2 104786832 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GCAGCATTCAGTCCTAACTGACAAGATA -3'
(R):5'- CGTGCTCATGTGTGCTTACTCCC -3'

Sequencing Primer
(F):5'- TCAGTCCTAACTGACAAGATAGATCC -3'
(R):5'- Ttctctctctctctctctctctctc -3'
Posted On2014-01-29