Incidental Mutation 'R1222:Slc4a5'
ID152758
Institutional Source Beutler Lab
Gene Symbol Slc4a5
Ensembl Gene ENSMUSG00000068323
Gene Namesolute carrier family 4, sodium bicarbonate cotransporter, member 5
SynonymsC330016K18Rik
MMRRC Submission 039291-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.494) question?
Stock #R1222 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location83219828-83304945 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83280132 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 640 (K640E)
Ref Sequence ENSEMBL: ENSMUSP00000109532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039212] [ENSMUST00000113899] [ENSMUST00000113900]
Predicted Effect probably damaging
Transcript: ENSMUST00000039212
AA Change: K640E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041007
Gene: ENSMUSG00000068323
AA Change: K640E

DomainStartEndE-ValueType
Pfam:Band_3_cyto 25 292 5.2e-102 PFAM
low complexity region 321 350 N/A INTRINSIC
Pfam:HCO3_cotransp 364 884 1.1e-242 PFAM
transmembrane domain 891 913 N/A INTRINSIC
low complexity region 936 951 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113899
AA Change: K640E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109532
Gene: ENSMUSG00000068323
AA Change: K640E

DomainStartEndE-ValueType
Pfam:Band_3_cyto 25 292 2.9e-102 PFAM
low complexity region 321 350 N/A INTRINSIC
Pfam:HCO3_cotransp 364 884 5.3e-243 PFAM
transmembrane domain 891 913 N/A INTRINSIC
low complexity region 936 951 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113900
AA Change: K755E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109533
Gene: ENSMUSG00000068323
AA Change: K755E

DomainStartEndE-ValueType
Pfam:Band_3_cyto 140 407 3.4e-106 PFAM
low complexity region 436 465 N/A INTRINSIC
Pfam:HCO3_cotransp 480 999 1.6e-224 PFAM
transmembrane domain 1006 1028 N/A INTRINSIC
low complexity region 1051 1066 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141863
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium bicarbonate cotransporter (NBC) family, part of the bicarbonate transporter superfamily. Sodium bicarbonate cotransporters are involved in intracellular pH regulation and electroneural or electrogenic sodium bicarbonate transport. This protein is thought to be an integral membrane protein. Multiple transcript variants encoding different isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit arterial hypertension and renal metabolic acidosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,145,064 probably benign Het
Abl1 T C 2: 31,800,994 S842P probably benign Het
Agrn C A 4: 156,177,385 V483L probably damaging Het
Ankrd13a T A 5: 114,800,763 C365* probably null Het
Ap2b1 T C 11: 83,346,738 S543P probably benign Het
Atic C T 1: 71,559,279 T67I probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cux1 C T 5: 136,275,149 R1391Q probably benign Het
Cyp2a4 T C 7: 26,308,588 V140A possibly damaging Het
Dlgap3 A T 4: 127,194,613 M1L probably null Het
Dnah3 T C 7: 120,090,676 D2G probably benign Het
Erbb3 A C 10: 128,571,665 V938G probably damaging Het
Fam13a C T 6: 58,935,722 probably benign Het
Gata2 G A 6: 88,200,341 V118I probably benign Het
Gm2663 T C 6: 40,996,041 I211V probably benign Het
Gm5096 A G 18: 87,757,334 K327R probably damaging Het
Gm8298 T A 3: 59,877,261 L385* probably null Het
Izumo3 T A 4: 92,145,047 N104I probably damaging Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Mctp2 T A 7: 72,259,139 H142L probably benign Het
Mmp10 T C 9: 7,505,681 probably benign Het
Mroh8 G A 2: 157,241,854 probably benign Het
Mylk T C 16: 34,860,652 V94A probably benign Het
Nol6 A T 4: 41,120,760 N396K probably benign Het
Nr4a2 A T 2: 57,108,324 N543K probably damaging Het
Nynrin T C 14: 55,863,541 S263P probably benign Het
Olfr1115 G T 2: 87,252,422 G162C probably benign Het
Olfr395 A T 11: 73,907,414 L26H probably damaging Het
Olfr493 T A 7: 108,346,106 I292F probably damaging Het
Olfr77 G A 9: 19,921,048 V280I possibly damaging Het
Pkhd1 T A 1: 20,567,456 R368S probably benign Het
Plekhg4 G A 8: 105,379,110 A736T probably benign Het
Plxna2 A G 1: 194,800,649 D1550G probably damaging Het
Qrfpr C A 3: 36,180,095 G366W probably damaging Het
Qser1 C A 2: 104,777,431 A1471S probably damaging Het
Rars A T 11: 35,809,740 Y505N probably damaging Het
Reln T A 5: 21,986,955 T1496S probably null Het
Rrs1 T C 1: 9,545,855 L111P probably benign Het
Selplg C T 5: 113,819,373 V291M possibly damaging Het
Serpinb1c T A 13: 32,896,951 T50S possibly damaging Het
Szt2 A T 4: 118,405,459 H40Q possibly damaging Het
Taar4 C T 10: 23,961,332 T280I probably benign Het
Tdo2 A G 3: 81,961,468 probably null Het
Tpp1 T C 7: 105,746,741 N527S probably benign Het
Trim43c A T 9: 88,843,078 T218S possibly damaging Het
Trim45 G T 3: 100,927,298 M432I probably benign Het
Ubr4 T C 4: 139,388,471 probably null Het
Vat1l T C 8: 114,282,361 probably benign Het
Xpo7 A T 14: 70,667,084 H1037Q possibly damaging Het
Zmiz1 T C 14: 25,658,096 probably benign Het
Other mutations in Slc4a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Slc4a5 APN 6 83285899 missense probably damaging 1.00
IGL00473:Slc4a5 APN 6 83296597 missense probably damaging 1.00
IGL00861:Slc4a5 APN 6 83299471 missense probably benign
IGL01025:Slc4a5 APN 6 83262533 missense probably damaging 0.98
IGL01532:Slc4a5 APN 6 83273040 splice site probably null
IGL01991:Slc4a5 APN 6 83263543 missense possibly damaging 0.94
IGL02271:Slc4a5 APN 6 83271103 splice site probably benign
IGL02565:Slc4a5 APN 6 83299505 missense probably benign 0.00
IGL02669:Slc4a5 APN 6 83263543 missense possibly damaging 0.79
IGL02994:Slc4a5 APN 6 83272124 missense probably damaging 1.00
IGL03259:Slc4a5 APN 6 83270997 missense probably damaging 1.00
IGL03264:Slc4a5 APN 6 83261525 missense probably damaging 1.00
R0032:Slc4a5 UTSW 6 83273157 missense probably damaging 1.00
R0091:Slc4a5 UTSW 6 83277555 missense probably benign 0.00
R0281:Slc4a5 UTSW 6 83267567 splice site probably benign
R0366:Slc4a5 UTSW 6 83295872 missense probably benign 0.02
R0668:Slc4a5 UTSW 6 83271072 missense probably damaging 1.00
R1550:Slc4a5 UTSW 6 83271057 missense probably damaging 1.00
R1585:Slc4a5 UTSW 6 83265687 missense probably damaging 1.00
R1731:Slc4a5 UTSW 6 83296635 missense probably damaging 1.00
R1987:Slc4a5 UTSW 6 83273232 missense possibly damaging 0.95
R2103:Slc4a5 UTSW 6 83224681 missense probably benign 0.00
R2103:Slc4a5 UTSW 6 83297378 missense probably benign 0.00
R2104:Slc4a5 UTSW 6 83297378 missense probably benign 0.00
R2176:Slc4a5 UTSW 6 83262560 missense probably damaging 0.98
R2920:Slc4a5 UTSW 6 83264387 missense probably damaging 1.00
R2964:Slc4a5 UTSW 6 83296669 missense probably damaging 1.00
R2965:Slc4a5 UTSW 6 83296669 missense probably damaging 1.00
R2966:Slc4a5 UTSW 6 83296669 missense probably damaging 1.00
R3755:Slc4a5 UTSW 6 83288303 missense probably benign 0.26
R3756:Slc4a5 UTSW 6 83288303 missense probably benign 0.26
R4293:Slc4a5 UTSW 6 83260529 missense probably damaging 1.00
R4789:Slc4a5 UTSW 6 83270969 missense probably benign 0.05
R4823:Slc4a5 UTSW 6 83272133 missense probably damaging 1.00
R4854:Slc4a5 UTSW 6 83271017 missense probably benign 0.00
R5461:Slc4a5 UTSW 6 83285854 missense probably benign 0.29
R5707:Slc4a5 UTSW 6 83261415 missense probably benign 0.11
R5747:Slc4a5 UTSW 6 83271029 missense probably damaging 1.00
R5978:Slc4a5 UTSW 6 83277536 missense probably benign 0.01
R6126:Slc4a5 UTSW 6 83226265 missense probably benign 0.05
R6330:Slc4a5 UTSW 6 83226374 missense probably benign
R6564:Slc4a5 UTSW 6 83280060 missense possibly damaging 0.71
R6786:Slc4a5 UTSW 6 83296747 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGAGCTGCCTGCTTATCATTCTCTG -3'
(R):5'- GACTAAGATGCAGTGTTCCTTCCCC -3'

Sequencing Primer
(F):5'- ACTGCCTAACAGGAGGGTC -3'
(R):5'- cacacacacacacacacacac -3'
Posted On2014-01-29