Incidental Mutation 'R1222:Mylk'
ID152781
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Namemyosin, light polypeptide kinase
SynonymsMlck, nmMlck, telokin, A930019C19Rik, 9530072E15Rik, MLCK108, MLCK210
MMRRC Submission 039291-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1222 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location34745210-35002420 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34860652 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 94 (V94A)
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
Predicted Effect probably benign
Transcript: ENSMUST00000023538
AA Change: V94A

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: V94A

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155268
Meta Mutation Damage Score 0.0424 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,145,064 probably benign Het
Abl1 T C 2: 31,800,994 S842P probably benign Het
Agrn C A 4: 156,177,385 V483L probably damaging Het
Ankrd13a T A 5: 114,800,763 C365* probably null Het
Ap2b1 T C 11: 83,346,738 S543P probably benign Het
Atic C T 1: 71,559,279 T67I probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Cux1 C T 5: 136,275,149 R1391Q probably benign Het
Cyp2a4 T C 7: 26,308,588 V140A possibly damaging Het
Dlgap3 A T 4: 127,194,613 M1L probably null Het
Dnah3 T C 7: 120,090,676 D2G probably benign Het
Erbb3 A C 10: 128,571,665 V938G probably damaging Het
Fam13a C T 6: 58,935,722 probably benign Het
Gata2 G A 6: 88,200,341 V118I probably benign Het
Gm2663 T C 6: 40,996,041 I211V probably benign Het
Gm5096 A G 18: 87,757,334 K327R probably damaging Het
Gm8298 T A 3: 59,877,261 L385* probably null Het
Izumo3 T A 4: 92,145,047 N104I probably damaging Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Mctp2 T A 7: 72,259,139 H142L probably benign Het
Mmp10 T C 9: 7,505,681 probably benign Het
Mroh8 G A 2: 157,241,854 probably benign Het
Nol6 A T 4: 41,120,760 N396K probably benign Het
Nr4a2 A T 2: 57,108,324 N543K probably damaging Het
Nynrin T C 14: 55,863,541 S263P probably benign Het
Olfr1115 G T 2: 87,252,422 G162C probably benign Het
Olfr395 A T 11: 73,907,414 L26H probably damaging Het
Olfr493 T A 7: 108,346,106 I292F probably damaging Het
Olfr77 G A 9: 19,921,048 V280I possibly damaging Het
Pkhd1 T A 1: 20,567,456 R368S probably benign Het
Plekhg4 G A 8: 105,379,110 A736T probably benign Het
Plxna2 A G 1: 194,800,649 D1550G probably damaging Het
Qrfpr C A 3: 36,180,095 G366W probably damaging Het
Qser1 C A 2: 104,777,431 A1471S probably damaging Het
Rars A T 11: 35,809,740 Y505N probably damaging Het
Reln T A 5: 21,986,955 T1496S probably null Het
Rrs1 T C 1: 9,545,855 L111P probably benign Het
Selplg C T 5: 113,819,373 V291M possibly damaging Het
Serpinb1c T A 13: 32,896,951 T50S possibly damaging Het
Slc4a5 A G 6: 83,280,132 K640E probably damaging Het
Szt2 A T 4: 118,405,459 H40Q possibly damaging Het
Taar4 C T 10: 23,961,332 T280I probably benign Het
Tdo2 A G 3: 81,961,468 probably null Het
Tpp1 T C 7: 105,746,741 N527S probably benign Het
Trim43c A T 9: 88,843,078 T218S possibly damaging Het
Trim45 G T 3: 100,927,298 M432I probably benign Het
Ubr4 T C 4: 139,388,471 probably null Het
Vat1l T C 8: 114,282,361 probably benign Het
Xpo7 A T 14: 70,667,084 H1037Q possibly damaging Het
Zmiz1 T C 14: 25,658,096 probably benign Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34938952 missense probably benign 0.36
IGL01386:Mylk APN 16 34971240 critical splice acceptor site probably null
IGL01684:Mylk APN 16 34971940 missense possibly damaging 0.55
IGL01884:Mylk APN 16 34988877 splice site probably benign
IGL02079:Mylk APN 16 34860631 missense possibly damaging 0.87
IGL02104:Mylk APN 16 34815435 missense probably benign 0.06
IGL02624:Mylk APN 16 34929896 missense probably benign 0.29
IGL02756:Mylk APN 16 34963646 missense probably benign 0.42
IGL02794:Mylk APN 16 34986541 missense probably benign 0.21
IGL02833:Mylk APN 16 34914900 missense probably benign 0.01
IGL02946:Mylk APN 16 34921788 missense probably benign 0.10
IGL03012:Mylk APN 16 34952781 missense probably benign 0.03
IGL03093:Mylk APN 16 34912192 missense possibly damaging 0.62
IGL03272:Mylk APN 16 34979189 missense probably benign 0.09
brutus UTSW 16 34953695 missense probably benign 0.12
popeye UTSW 16 34963577 missense probably benign 0.29
F5770:Mylk UTSW 16 34995204 critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34977113 splice site probably benign
PIT4382001:Mylk UTSW 16 34875642 missense probably damaging 0.99
R0131:Mylk UTSW 16 34875504 missense probably benign 0.03
R0309:Mylk UTSW 16 34912297 splice site probably benign
R0358:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0381:Mylk UTSW 16 34784974 utr 5 prime probably null
R0390:Mylk UTSW 16 34875620 missense probably damaging 0.97
R0413:Mylk UTSW 16 34921944 missense probably benign 0.01
R0536:Mylk UTSW 16 35000387 missense possibly damaging 0.95
R0544:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0545:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0546:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0547:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0548:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0627:Mylk UTSW 16 35000429 missense probably damaging 1.00
R0726:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0755:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0782:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0783:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0784:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1136:Mylk UTSW 16 35000318 missense probably damaging 1.00
R1170:Mylk UTSW 16 34874039 missense probably benign 0.20
R1445:Mylk UTSW 16 34815465 missense possibly damaging 0.57
R1583:Mylk UTSW 16 34875586 missense probably benign 0.29
R1618:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1643:Mylk UTSW 16 34875635 missense probably benign 0.03
R1702:Mylk UTSW 16 34921944 missense probably benign 0.00
R1776:Mylk UTSW 16 34952782 missense probably benign 0.16
R1865:Mylk UTSW 16 34912230 missense probably benign 0.03
R1975:Mylk UTSW 16 34880303 splice site probably null
R2016:Mylk UTSW 16 34996817 missense probably damaging 1.00
R2045:Mylk UTSW 16 34953653 missense probably benign 0.29
R2134:Mylk UTSW 16 34986476 missense probably benign 0.13
R3547:Mylk UTSW 16 34880168 missense possibly damaging 0.61
R3844:Mylk UTSW 16 34921877 missense probably benign 0.01
R4003:Mylk UTSW 16 34963577 missense probably benign 0.29
R4396:Mylk UTSW 16 34912275 nonsense probably null
R4470:Mylk UTSW 16 34912152 missense probably benign 0.09
R4507:Mylk UTSW 16 34953695 missense probably benign 0.12
R4700:Mylk UTSW 16 34922435 missense probably benign 0.16
R4751:Mylk UTSW 16 34879169 missense probably benign 0.29
R4815:Mylk UTSW 16 34894925 missense probably damaging 0.97
R4832:Mylk UTSW 16 34922367 missense probably benign 0.36
R4872:Mylk UTSW 16 34914990 missense possibly damaging 0.89
R4953:Mylk UTSW 16 34988961 missense probably damaging 1.00
R4969:Mylk UTSW 16 34971440 missense probably damaging 0.96
R5009:Mylk UTSW 16 34899507 missense probably benign 0.39
R5130:Mylk UTSW 16 34988997 missense probably damaging 1.00
R5173:Mylk UTSW 16 34977013 missense probably benign 0.40
R5195:Mylk UTSW 16 34979215 missense probably damaging 1.00
R5209:Mylk UTSW 16 34922625 missense possibly damaging 0.55
R5311:Mylk UTSW 16 34921757 missense probably benign 0.01
R5418:Mylk UTSW 16 34912230 missense probably benign 0.02
R5481:Mylk UTSW 16 34921604 missense probably benign 0.09
R5590:Mylk UTSW 16 34879352 missense probably benign 0.29
R5603:Mylk UTSW 16 34956492 missense probably benign 0.06
R5823:Mylk UTSW 16 34894947 critical splice donor site probably null
R6290:Mylk UTSW 16 34894843 missense probably benign 0.39
R6351:Mylk UTSW 16 34921971 missense probably benign 0.01
R6365:Mylk UTSW 16 34860591 missense probably benign 0.12
R6490:Mylk UTSW 16 34929867 missense possibly damaging 0.74
R6723:Mylk UTSW 16 34929888 missense possibly damaging 0.74
R6864:Mylk UTSW 16 34874150 missense probably benign 0.03
R6908:Mylk UTSW 16 34880273 missense probably benign 0.18
R6949:Mylk UTSW 16 35000318 missense probably damaging 1.00
R7018:Mylk UTSW 16 35000426 missense possibly damaging 0.88
R7035:Mylk UTSW 16 34976982 missense possibly damaging 0.89
R7162:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7236:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7269:Mylk UTSW 16 34785011 missense probably damaging 0.96
V7580:Mylk UTSW 16 34995204 critical splice donor site probably null
V7583:Mylk UTSW 16 34995204 critical splice donor site probably null
X0065:Mylk UTSW 16 35000441 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGACCCAGTGTGTAATGCACAG -3'
(R):5'- AAACAGGGTGCGGCTTCTCTTC -3'

Sequencing Primer
(F):5'- CAGAAAGTGTGAACTCTGAACTC -3'
(R):5'- AAGTCCCTCCATCTTTGAGAGAG -3'
Posted On2014-01-29