Incidental Mutation 'R1223:Commd3'
ID152786
Institutional Source Beutler Lab
Gene Symbol Commd3
Ensembl Gene ENSMUSG00000051154
Gene NameCOMM domain containing 3
SynonymsBup, D2Ertd542e
MMRRC Submission 039292-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.776) question?
Stock #R1223 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location18672384-18676231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18674968 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 163 (Y163H)
Ref Sequence ENSEMBL: ENSMUSP00000127385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028071] [ENSMUST00000061158] [ENSMUST00000150834] [ENSMUST00000171845]
Predicted Effect probably benign
Transcript: ENSMUST00000028071
SMART Domains Protein: ENSMUSP00000028071
Gene: ENSMUSG00000026739

DomainStartEndE-ValueType
RING 18 56 4.34e-5 SMART
low complexity region 146 159 N/A INTRINSIC
low complexity region 264 276 N/A INTRINSIC
low complexity region 313 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061158
AA Change: Y163H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000049882
Gene: ENSMUSG00000051154
AA Change: Y163H

DomainStartEndE-ValueType
Pfam:HCaRG 18 191 5.4e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150590
Predicted Effect probably benign
Transcript: ENSMUST00000150834
SMART Domains Protein: ENSMUSP00000119331
Gene: ENSMUSG00000026739

DomainStartEndE-ValueType
RING 18 56 4.34e-5 SMART
low complexity region 146 159 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154519
Predicted Effect probably benign
Transcript: ENSMUST00000171845
AA Change: Y163H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127385
Gene: ENSMUSG00000051154
AA Change: Y163H

DomainStartEndE-ValueType
Pfam:HCaRG 14 192 1.2e-54 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A T 16: 4,298,748 V873E probably damaging Het
Arl10 A G 13: 54,578,931 D174G probably damaging Het
Cd180 A T 13: 102,706,222 Y592F possibly damaging Het
Ces3a A T 8: 105,058,029 T548S probably benign Het
Chd2 T C 7: 73,484,517 E694G probably damaging Het
Cyp8b1 A G 9: 121,915,004 S421P possibly damaging Het
Cysltr2 A T 14: 73,030,099 V57E probably damaging Het
D430042O09Rik T A 7: 125,760,423 V62E possibly damaging Het
Ddx47 G A 6: 135,012,314 V34I possibly damaging Het
Dgkz T C 2: 91,939,315 probably benign Het
Dsg2 G T 18: 20,573,493 C22F probably benign Het
Gbp10 A C 5: 105,219,001 V455G probably damaging Het
Gm12185 T A 11: 48,907,276 I797F probably damaging Het
Lrrk2 A G 15: 91,673,635 E58G probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mybphl A G 3: 108,375,196 T182A possibly damaging Het
Olfr1154 G A 2: 87,902,819 P286S probably damaging Het
Olfr676 A T 7: 105,035,566 I123F probably benign Het
Osr1 C T 12: 9,579,699 L191F probably damaging Het
Pip4k2b G A 11: 97,718,894 R406C probably damaging Het
Plce1 C T 19: 38,702,013 L714F probably damaging Het
Plce1 T C 19: 38,767,226 F1886S probably damaging Het
Ppp1cc A G 5: 122,168,214 E32G probably damaging Het
Rnh1 A G 7: 141,163,207 L260P probably damaging Het
Serpinb3a T A 1: 107,047,552 N175I probably damaging Het
Sptbn5 T A 2: 120,072,044 I68F probably damaging Het
Tas1r2 A T 4: 139,660,204 T325S probably damaging Het
Tcirg1 T C 19: 3,898,733 N484S probably benign Het
Tenm3 A T 8: 48,240,396 M1833K possibly damaging Het
Thoc5 A G 11: 4,921,922 E449G probably benign Het
Usp34 A G 11: 23,446,464 probably null Het
Other mutations in Commd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Commd3 APN 2 18673928 missense possibly damaging 0.68
IGL00972:Commd3 APN 2 18674665 missense probably benign 0.04
IGL01309:Commd3 APN 2 18672478 missense probably benign 0.26
IGL01575:Commd3 APN 2 18674717 critical splice donor site probably null
IGL02207:Commd3 APN 2 18674008 critical splice donor site probably null
R0062:Commd3 UTSW 2 18674703 unclassified probably null
R0062:Commd3 UTSW 2 18674703 unclassified probably null
R0699:Commd3 UTSW 2 18674975 missense possibly damaging 0.50
R1959:Commd3 UTSW 2 18673963 missense probably benign 0.07
R3011:Commd3 UTSW 2 18674688 missense probably damaging 1.00
R4710:Commd3 UTSW 2 18674282 missense probably benign 0.02
R4821:Commd3 UTSW 2 18672528 missense probably benign
R5098:Commd3 UTSW 2 18674177 missense possibly damaging 0.85
R5456:Commd3 UTSW 2 18674157 missense probably damaging 0.96
R5891:Commd3 UTSW 2 18673815 intron probably benign
R6511:Commd3 UTSW 2 18674839 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGGCGCTTGGAGTACCAGATAAAG -3'
(R):5'- AAATGCAGGCTACTGGGGATGTTAC -3'

Sequencing Primer
(F):5'- CTTGGAGTACCAGATAAAGGTAAAG -3'
(R):5'- GCTACTGGGGATGTTACTATGTTAC -3'
Posted On2014-01-29