Incidental Mutation 'R1223:Mybphl'
ID152790
Institutional Source Beutler Lab
Gene Symbol Mybphl
Ensembl Gene ENSMUSG00000068745
Gene Namemyosin binding protein H-like
Synonyms
MMRRC Submission 039292-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R1223 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location108364911-108380057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108375196 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 182 (T182A)
Ref Sequence ENSEMBL: ENSMUSP00000088051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090563]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090563
AA Change: T182A

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088051
Gene: ENSMUSG00000068745
AA Change: T182A

DomainStartEndE-ValueType
IG 61 144 4.67e-4 SMART
FN3 147 229 1.62e-10 SMART
IG 268 352 3.68e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142833
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two immunoglobulin superfamily domains and a fibronectin 3 domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A T 16: 4,298,748 V873E probably damaging Het
Arl10 A G 13: 54,578,931 D174G probably damaging Het
Cd180 A T 13: 102,706,222 Y592F possibly damaging Het
Ces3a A T 8: 105,058,029 T548S probably benign Het
Chd2 T C 7: 73,484,517 E694G probably damaging Het
Commd3 T C 2: 18,674,968 Y163H probably benign Het
Cyp8b1 A G 9: 121,915,004 S421P possibly damaging Het
Cysltr2 A T 14: 73,030,099 V57E probably damaging Het
D430042O09Rik T A 7: 125,760,423 V62E possibly damaging Het
Ddx47 G A 6: 135,012,314 V34I possibly damaging Het
Dgkz T C 2: 91,939,315 probably benign Het
Dsg2 G T 18: 20,573,493 C22F probably benign Het
Gbp10 A C 5: 105,219,001 V455G probably damaging Het
Gm12185 T A 11: 48,907,276 I797F probably damaging Het
Lrrk2 A G 15: 91,673,635 E58G probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Olfr1154 G A 2: 87,902,819 P286S probably damaging Het
Olfr676 A T 7: 105,035,566 I123F probably benign Het
Osr1 C T 12: 9,579,699 L191F probably damaging Het
Pip4k2b G A 11: 97,718,894 R406C probably damaging Het
Plce1 C T 19: 38,702,013 L714F probably damaging Het
Plce1 T C 19: 38,767,226 F1886S probably damaging Het
Ppp1cc A G 5: 122,168,214 E32G probably damaging Het
Rnh1 A G 7: 141,163,207 L260P probably damaging Het
Serpinb3a T A 1: 107,047,552 N175I probably damaging Het
Sptbn5 T A 2: 120,072,044 I68F probably damaging Het
Tas1r2 A T 4: 139,660,204 T325S probably damaging Het
Tcirg1 T C 19: 3,898,733 N484S probably benign Het
Tenm3 A T 8: 48,240,396 M1833K possibly damaging Het
Thoc5 A G 11: 4,921,922 E449G probably benign Het
Usp34 A G 11: 23,446,464 probably null Het
Other mutations in Mybphl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03365:Mybphl APN 3 108364998 start codon destroyed probably null 0.98
IGL03389:Mybphl APN 3 108375718 missense probably benign 0.09
R0194:Mybphl UTSW 3 108374168 missense probably benign 0.01
R0206:Mybphl UTSW 3 108375415 missense probably damaging 1.00
R0206:Mybphl UTSW 3 108375415 missense probably damaging 1.00
R0208:Mybphl UTSW 3 108375415 missense probably damaging 1.00
R1067:Mybphl UTSW 3 108365003 missense probably benign
R1748:Mybphl UTSW 3 108375084 critical splice acceptor site probably null
R2013:Mybphl UTSW 3 108375402 missense probably benign 0.02
R2102:Mybphl UTSW 3 108375633 missense possibly damaging 0.82
R2121:Mybphl UTSW 3 108375176 missense probably damaging 1.00
R2197:Mybphl UTSW 3 108377319 missense probably damaging 1.00
R2265:Mybphl UTSW 3 108365001 missense probably damaging 1.00
R2266:Mybphl UTSW 3 108365001 missense probably damaging 1.00
R2267:Mybphl UTSW 3 108365001 missense probably damaging 1.00
R2268:Mybphl UTSW 3 108365001 missense probably damaging 1.00
R4551:Mybphl UTSW 3 108374163 missense possibly damaging 0.49
R4570:Mybphl UTSW 3 108365031 missense possibly damaging 0.61
R4693:Mybphl UTSW 3 108375178 missense probably benign 0.01
R5759:Mybphl UTSW 3 108374754 missense probably benign 0.30
R7017:Mybphl UTSW 3 108374838 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCAGACACGGTGGTAGGTGATG -3'
(R):5'- TGGTAACGCTCCAGGACTGTGAAC -3'

Sequencing Primer
(F):5'- GTATTCTGTAGTGAGGTTGCCAC -3'
(R):5'- ACATGGAGCTGCCAGAAGAT -3'
Posted On2014-01-29