Incidental Mutation 'R1223:Gbp10'
ID152794
Institutional Source Beutler Lab
Gene Symbol Gbp10
Ensembl Gene ENSMUSG00000105096
Gene Nameguanylate-binding protein 10
Synonyms
MMRRC Submission 039292-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R1223 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location105215699-105239533 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 105219001 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 455 (V455G)
Ref Sequence ENSEMBL: ENSMUSP00000069042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050011] [ENSMUST00000065588]
Predicted Effect probably benign
Transcript: ENSMUST00000050011
SMART Domains Protein: ENSMUSP00000062528
Gene: ENSMUSG00000079362

DomainStartEndE-ValueType
Pfam:GBP 16 279 7.6e-118 PFAM
Pfam:GBP_C 281 575 2.1e-117 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000065588
AA Change: V455G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069042
Gene: ENSMUSG00000105096
AA Change: V455G

DomainStartEndE-ValueType
Pfam:GBP 16 279 5e-115 PFAM
Pfam:GBP_C 281 575 3.6e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196634
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A T 16: 4,298,748 V873E probably damaging Het
Arl10 A G 13: 54,578,931 D174G probably damaging Het
Cd180 A T 13: 102,706,222 Y592F possibly damaging Het
Ces3a A T 8: 105,058,029 T548S probably benign Het
Chd2 T C 7: 73,484,517 E694G probably damaging Het
Commd3 T C 2: 18,674,968 Y163H probably benign Het
Cyp8b1 A G 9: 121,915,004 S421P possibly damaging Het
Cysltr2 A T 14: 73,030,099 V57E probably damaging Het
D430042O09Rik T A 7: 125,760,423 V62E possibly damaging Het
Ddx47 G A 6: 135,012,314 V34I possibly damaging Het
Dgkz T C 2: 91,939,315 probably benign Het
Dsg2 G T 18: 20,573,493 C22F probably benign Het
Gm12185 T A 11: 48,907,276 I797F probably damaging Het
Lrrk2 A G 15: 91,673,635 E58G probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mybphl A G 3: 108,375,196 T182A possibly damaging Het
Olfr1154 G A 2: 87,902,819 P286S probably damaging Het
Olfr676 A T 7: 105,035,566 I123F probably benign Het
Osr1 C T 12: 9,579,699 L191F probably damaging Het
Pip4k2b G A 11: 97,718,894 R406C probably damaging Het
Plce1 C T 19: 38,702,013 L714F probably damaging Het
Plce1 T C 19: 38,767,226 F1886S probably damaging Het
Ppp1cc A G 5: 122,168,214 E32G probably damaging Het
Rnh1 A G 7: 141,163,207 L260P probably damaging Het
Serpinb3a T A 1: 107,047,552 N175I probably damaging Het
Sptbn5 T A 2: 120,072,044 I68F probably damaging Het
Tas1r2 A T 4: 139,660,204 T325S probably damaging Het
Tcirg1 T C 19: 3,898,733 N484S probably benign Het
Tenm3 A T 8: 48,240,396 M1833K possibly damaging Het
Thoc5 A G 11: 4,921,922 E449G probably benign Het
Usp34 A G 11: 23,446,464 probably null Het
Other mutations in Gbp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01470:Gbp10 APN 5 105221114 splice site probably benign
IGL01680:Gbp10 APN 5 105224271 splice site probably null
IGL01809:Gbp10 APN 5 105217359 missense probably benign
IGL01845:Gbp10 APN 5 105219949 splice site probably null
IGL02011:Gbp10 APN 5 105221101 missense probably damaging 1.00
IGL02063:Gbp10 APN 5 105236040 missense possibly damaging 0.95
IGL02533:Gbp10 APN 5 105220035 missense probably damaging 1.00
IGL02612:Gbp10 APN 5 105218502 missense possibly damaging 0.88
R0349:Gbp10 UTSW 5 105221076 missense possibly damaging 0.60
R0462:Gbp10 UTSW 5 105218524 missense possibly damaging 0.67
R0535:Gbp10 UTSW 5 105221011 missense possibly damaging 0.95
R1704:Gbp10 UTSW 5 105224351 missense probably damaging 1.00
R1792:Gbp10 UTSW 5 105224300 missense probably damaging 1.00
R3738:Gbp10 UTSW 5 105224458 missense possibly damaging 0.84
R3739:Gbp10 UTSW 5 105224458 missense possibly damaging 0.84
R4035:Gbp10 UTSW 5 105224458 missense possibly damaging 0.84
R4421:Gbp10 UTSW 5 105224651 splice site probably null
R5207:Gbp10 UTSW 5 105224709 missense probably benign 0.05
R5338:Gbp10 UTSW 5 105224300 missense probably damaging 1.00
R6010:Gbp10 UTSW 5 105224339 missense probably damaging 1.00
R6045:Gbp10 UTSW 5 105218403 missense probably damaging 0.98
R6156:Gbp10 UTSW 5 105236149 start gained probably benign
R6285:Gbp10 UTSW 5 105218460 missense probably damaging 1.00
R6525:Gbp10 UTSW 5 105236084 missense probably benign 0.01
R6908:Gbp10 UTSW 5 105221032 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGCATACAGATTGGGCATTCACAG -3'
(R):5'- TACTGGACTAAGCCACAGAGCAGG -3'

Sequencing Primer
(F):5'- CGACTGATCTGGCATGGATTTAC -3'
(R):5'- CAGGAAGTATCCAGGTCACTG -3'
Posted On2014-01-29