Incidental Mutation 'R1223:Pip4k2b'
ID152810
Institutional Source Beutler Lab
Gene Symbol Pip4k2b
Ensembl Gene ENSMUSG00000018547
Gene Namephosphatidylinositol-5-phosphate 4-kinase, type II, beta
SynonymsPip5k2b, PI5P4Kbeta, c11
MMRRC Submission 039292-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R1223 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location97715157-97744704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 97718894 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 406 (R406C)
Ref Sequence ENSEMBL: ENSMUSP00000018691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018691]
Predicted Effect probably damaging
Transcript: ENSMUST00000018691
AA Change: R406C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018691
Gene: ENSMUSG00000018547
AA Change: R406C

DomainStartEndE-ValueType
PIPKc 67 416 4.49e-156 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144012
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the phosphorylation of phosphatidylinositol-5-phosphate on the fourth hydroxyl of the myo-inositol ring to form phosphatidylinositol-5,4-bisphosphate. This gene is a member of the phosphatidylinositol-5-phosphate 4-kinase family. The encoded protein sequence does not show similarity to other kinases, but the protein does exhibit kinase activity. Additionally, the encoded protein interacts with p55 TNF receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are smaller than normal with less body fat and an increased sensitivity to insulin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A T 16: 4,298,748 V873E probably damaging Het
Arl10 A G 13: 54,578,931 D174G probably damaging Het
Cd180 A T 13: 102,706,222 Y592F possibly damaging Het
Ces3a A T 8: 105,058,029 T548S probably benign Het
Chd2 T C 7: 73,484,517 E694G probably damaging Het
Commd3 T C 2: 18,674,968 Y163H probably benign Het
Cyp8b1 A G 9: 121,915,004 S421P possibly damaging Het
Cysltr2 A T 14: 73,030,099 V57E probably damaging Het
D430042O09Rik T A 7: 125,760,423 V62E possibly damaging Het
Ddx47 G A 6: 135,012,314 V34I possibly damaging Het
Dgkz T C 2: 91,939,315 probably benign Het
Dsg2 G T 18: 20,573,493 C22F probably benign Het
Gbp10 A C 5: 105,219,001 V455G probably damaging Het
Gm12185 T A 11: 48,907,276 I797F probably damaging Het
Lrrk2 A G 15: 91,673,635 E58G probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mybphl A G 3: 108,375,196 T182A possibly damaging Het
Olfr1154 G A 2: 87,902,819 P286S probably damaging Het
Olfr676 A T 7: 105,035,566 I123F probably benign Het
Osr1 C T 12: 9,579,699 L191F probably damaging Het
Plce1 C T 19: 38,702,013 L714F probably damaging Het
Plce1 T C 19: 38,767,226 F1886S probably damaging Het
Ppp1cc A G 5: 122,168,214 E32G probably damaging Het
Rnh1 A G 7: 141,163,207 L260P probably damaging Het
Serpinb3a T A 1: 107,047,552 N175I probably damaging Het
Sptbn5 T A 2: 120,072,044 I68F probably damaging Het
Tas1r2 A T 4: 139,660,204 T325S probably damaging Het
Tcirg1 T C 19: 3,898,733 N484S probably benign Het
Tenm3 A T 8: 48,240,396 M1833K possibly damaging Het
Thoc5 A G 11: 4,921,922 E449G probably benign Het
Usp34 A G 11: 23,446,464 probably null Het
Other mutations in Pip4k2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Pip4k2b APN 11 97744505 missense probably damaging 1.00
IGL01567:Pip4k2b APN 11 97729561 missense probably damaging 0.99
IGL01568:Pip4k2b APN 11 97729552 critical splice donor site probably null
IGL03004:Pip4k2b APN 11 97724474 missense probably damaging 1.00
bigun UTSW 11 97722936 splice site probably benign
yuge UTSW 11 97722434 missense probably benign 0.04
R0119:Pip4k2b UTSW 11 97722936 splice site probably benign
R0657:Pip4k2b UTSW 11 97722936 splice site probably benign
R1252:Pip4k2b UTSW 11 97744594 missense probably benign 0.45
R2914:Pip4k2b UTSW 11 97722434 missense probably benign 0.04
R3702:Pip4k2b UTSW 11 97729548 splice site probably benign
R4173:Pip4k2b UTSW 11 97722375 missense probably benign 0.06
R4998:Pip4k2b UTSW 11 97722435 missense possibly damaging 0.49
R5084:Pip4k2b UTSW 11 97719743 missense probably damaging 1.00
R5128:Pip4k2b UTSW 11 97718876 missense probably benign 0.01
R6590:Pip4k2b UTSW 11 97729567 missense probably damaging 1.00
R6690:Pip4k2b UTSW 11 97729567 missense probably damaging 1.00
R7104:Pip4k2b UTSW 11 97732716 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GCAGTCCCTTAACTAAAGCCCTCG -3'
(R):5'- AGCTCTGATGTGACATACAAGCCAC -3'

Sequencing Primer
(F):5'- TTAACTAAAGCCCTCGCAAGC -3'
(R):5'- gtttgtttgtttgtttgtttgtttTC -3'
Posted On2014-01-29