Incidental Mutation 'R1225:Slc9a8'
ID152859
Institutional Source Beutler Lab
Gene Symbol Slc9a8
Ensembl Gene ENSMUSG00000039463
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 8
Synonyms1200006P13Rik, 6430709P13Rik, NHE8
MMRRC Submission 039294-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1225 (G1)
Quality Score192
Status Validated
Chromosome2
Chromosomal Location167421712-167477000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 167471523 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 435 (I435T)
Ref Sequence ENSEMBL: ENSMUSP00000104841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047815] [ENSMUST00000073873] [ENSMUST00000109218]
Predicted Effect probably benign
Transcript: ENSMUST00000047815
AA Change: I466T

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000044185
Gene: ENSMUSG00000039463
AA Change: I466T

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 57 468 3.3e-69 PFAM
low complexity region 497 513 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073873
AA Change: I439T

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000073536
Gene: ENSMUSG00000039463
AA Change: I439T

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 441 3.5e-62 PFAM
low complexity region 470 486 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109218
AA Change: I435T

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104841
Gene: ENSMUSG00000039463
AA Change: I435T

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 437 3.7e-61 PFAM
low complexity region 466 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155585
Meta Mutation Damage Score 0.2 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: This gene encodes a member of the Na+/H+ exchanger (NHE) family of integral membrane transporter proteins. The encoded protein is expressed on the apical membrane of the intestinal epithelial cells and plays an important role in mucosal protection. Loss of the encoded protein in mice results in a decrease in the number of goblet and mucin-positive cells, disorganization of the mucin layer, and a decrease in mucosal pH in the colon. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male infertility, impaired mucin synthesis and bicarbonate secretion in the colon, abnormal blood coagulation and increased length of the small intestine, cecum and ileum crypts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A T 9: 103,254,839 probably benign Het
A730013G03Rik T A 1: 192,833,645 noncoding transcript Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ahnak T A 19: 9,002,883 D510E probably damaging Het
Angptl4 C T 17: 33,781,191 A68T possibly damaging Het
Arid1a A G 4: 133,687,365 V1185A unknown Het
Atp2c2 C A 8: 119,735,245 Q286K probably damaging Het
Blzf1 T C 1: 164,299,596 E209G probably damaging Het
Bmp6 A G 13: 38,346,281 T117A probably benign Het
Cmip T C 8: 117,445,371 F394L probably damaging Het
Col6a3 T A 1: 90,811,516 D330V probably damaging Het
Crebbp A T 16: 4,126,956 S491R probably benign Het
Dedd G A 1: 171,340,295 probably null Het
Dennd4a A G 9: 64,911,675 H1704R probably benign Het
Dicer1 C T 12: 104,691,607 V1903I probably damaging Het
Dnah9 A G 11: 65,871,060 V3868A possibly damaging Het
Eif5b A G 1: 38,037,628 I674V probably damaging Het
F13a1 T C 13: 37,025,851 N47D probably benign Het
Fancd2 T C 6: 113,535,861 S53P probably damaging Het
Fsip1 C A 2: 118,248,350 L170F probably damaging Het
Git2 A T 5: 114,733,178 probably benign Het
Gm9742 T C 13: 8,029,839 noncoding transcript Het
Heatr4 C T 12: 83,978,046 E334K probably benign Het
Hoga1 T G 19: 42,070,189 V110G probably damaging Het
Ighv6-4 T A 12: 114,406,550 D75V probably damaging Het
Med15 G T 16: 17,722,788 S31R probably damaging Het
Nbeal2 T C 9: 110,632,886 E1467G probably damaging Het
Olfr201 T C 16: 59,269,224 T148A probably benign Het
Olfr705 A T 7: 106,714,524 D52E probably benign Het
Olfr720 T A 14: 14,175,600 I161F possibly damaging Het
Papss1 T C 3: 131,579,301 probably benign Het
Pde4d A T 13: 109,950,221 M610L probably benign Het
Prickle4 T G 17: 47,688,689 probably null Het
Sema3g A G 14: 31,220,679 Y79C probably damaging Het
Setbp1 T A 18: 78,858,208 D748V probably damaging Het
Slc46a2 A T 4: 59,914,125 V266E probably benign Het
Snx29 T C 16: 11,420,686 probably benign Het
Son C T 16: 91,657,340 R992C probably damaging Het
Stxbp5 T C 10: 9,812,391 N389D possibly damaging Het
Vmn1r28 C T 6: 58,265,966 Q265* probably null Het
Other mutations in Slc9a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Slc9a8 APN 2 167424166 missense possibly damaging 0.46
IGL02626:Slc9a8 APN 2 167467677 splice site probably benign
costello UTSW 2 167451296 missense probably damaging 1.00
R0270:Slc9a8 UTSW 2 167451296 missense probably damaging 1.00
R0417:Slc9a8 UTSW 2 167457344 missense probably benign 0.00
R0504:Slc9a8 UTSW 2 167424205 missense probably benign
R0906:Slc9a8 UTSW 2 167434867 intron probably benign
R1216:Slc9a8 UTSW 2 167424121 missense probably benign 0.00
R1604:Slc9a8 UTSW 2 167471432 missense probably benign 0.09
R1728:Slc9a8 UTSW 2 167424145 missense probably benign 0.00
R1729:Slc9a8 UTSW 2 167424145 missense probably benign 0.00
R1773:Slc9a8 UTSW 2 167471465 missense possibly damaging 0.57
R1775:Slc9a8 UTSW 2 167457358 missense probably benign 0.12
R1918:Slc9a8 UTSW 2 167424214 missense possibly damaging 0.95
R2312:Slc9a8 UTSW 2 167451276 missense probably benign 0.01
R3031:Slc9a8 UTSW 2 167451281 missense probably damaging 1.00
R3752:Slc9a8 UTSW 2 167457352 missense probably benign
R3757:Slc9a8 UTSW 2 167424130 missense probably benign 0.01
R4499:Slc9a8 UTSW 2 167424193 missense probably benign 0.01
R4746:Slc9a8 UTSW 2 167441170 nonsense probably null
R4904:Slc9a8 UTSW 2 167471396 missense possibly damaging 0.51
R4969:Slc9a8 UTSW 2 167446529 missense probably benign 0.06
R5395:Slc9a8 UTSW 2 167467722 missense probably damaging 0.99
R5811:Slc9a8 UTSW 2 167471387 nonsense probably null
R5908:Slc9a8 UTSW 2 167451170 intron probably benign
R6311:Slc9a8 UTSW 2 167451220 missense probably damaging 1.00
R6443:Slc9a8 UTSW 2 167434821 missense probably benign 0.00
R6494:Slc9a8 UTSW 2 167424291 missense probably damaging 1.00
R7161:Slc9a8 UTSW 2 167465383 missense possibly damaging 0.90
R7322:Slc9a8 UTSW 2 167451302 missense probably damaging 1.00
R7354:Slc9a8 UTSW 2 167474131 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGCCATTCCCATCAGAATCAGATCC -3'
(R):5'- AAGAGCCCTGTTTCAGAAGCCAAG -3'

Sequencing Primer
(F):5'- CTAAAGCCACCCTGGAGC -3'
(R):5'- TGGCTCCGAGGTAAGCAC -3'
Posted On2014-01-29