Incidental Mutation 'R0096:Olfr910'
ID155835
Institutional Source Beutler Lab
Gene Symbol Olfr910
Ensembl Gene ENSMUSG00000060114
Gene Nameolfactory receptor 910
SynonymsMOR165-3, GA_x6K02T2PVTD-32239063-32239995
MMRRC Submission 038382-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R0096 (G1)
Quality Score44
Status Validated
Chromosome9
Chromosomal Location38537849-38540820 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38539536 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 214 (I214F)
Ref Sequence ENSEMBL: ENSMUSP00000149263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000215122]
Predicted Effect probably damaging
Transcript: ENSMUST00000073214
AA Change: I214F

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072947
Gene: ENSMUSG00000057444
AA Change: I214F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.9e-49 PFAM
Pfam:7tm_1 41 290 4.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215122
AA Change: I214F

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.0272 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.5%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A C 6: 48,931,188 Q374P probably damaging Het
4933405L10Rik A T 8: 105,708,931 probably null Het
Adamts3 G A 5: 89,701,717 Q615* probably null Het
Adamtsl3 T A 7: 82,465,699 probably benign Het
Anks1b T C 10: 90,074,062 S48P possibly damaging Het
Arfip2 T A 7: 105,638,230 K94N probably damaging Het
Arhgap42 G T 9: 9,009,313 N524K probably damaging Het
Arhgef28 T G 13: 97,931,254 T1388P probably damaging Het
Arid4b T C 13: 14,129,194 V68A probably benign Het
BC005537 T C 13: 24,805,940 F129L probably damaging Het
Capn3 A T 2: 120,502,529 H592L possibly damaging Het
Ccdc105 T A 10: 78,748,705 I328L probably benign Het
Dglucy A T 12: 100,838,651 I134F possibly damaging Het
Dhh T A 15: 98,893,988 M380L probably benign Het
Dnaic2 A C 11: 114,754,332 D531A probably benign Het
Dthd1 A T 5: 62,843,040 R568S possibly damaging Het
Efr3a A G 15: 65,855,441 N613S probably damaging Het
Epb41l5 T A 1: 119,623,911 probably benign Het
Ermp1 A G 19: 29,631,388 Y164H possibly damaging Het
Fam120c CCAGCAGCAGCAGCAGCA CCAGCAGCAGCAGCA X: 151,344,345 probably benign Het
Fbrs C T 7: 127,489,487 A145V probably damaging Het
Gm4736 T C 6: 132,115,606 noncoding transcript Het
Gm9873 A T 2: 169,021,109 noncoding transcript Het
Grik1 T C 16: 88,034,226 M219V possibly damaging Het
Gtsf1l C T 2: 163,087,536 C9Y probably damaging Het
Itih5 G A 2: 10,251,378 R885Q probably benign Het
Kdm4c A G 4: 74,357,343 E752G probably damaging Het
Ksr1 A G 11: 79,038,247 probably benign Het
Lama1 T A 17: 67,805,413 F2283I probably benign Het
Luc7l3 A G 11: 94,301,494 probably benign Het
Lypd8 A T 11: 58,386,757 M122L probably benign Het
Map1a A G 2: 121,301,505 E696G probably damaging Het
Mrps34 A G 17: 24,895,669 D110G probably damaging Het
Myh11 T A 16: 14,204,367 K1710M possibly damaging Het
Myo1d A G 11: 80,484,332 L972P probably damaging Het
Nos1ap T C 1: 170,329,247 D214G probably damaging Het
Olfr1224-ps1 A T 2: 89,156,296 M293K probably benign Het
Pate4 T G 9: 35,611,834 T5P probably damaging Het
Pygl A T 12: 70,191,166 probably benign Het
Samd4 A T 14: 47,064,297 M252L possibly damaging Het
Serpinb1c T A 13: 32,886,283 probably benign Het
Sis A T 3: 72,928,267 W921R probably damaging Het
Skint5 A T 4: 113,597,768 probably benign Het
Slc27a6 T C 18: 58,598,757 probably benign Het
Sycp2 G T 2: 178,403,735 Q31K probably damaging Het
Taar7f A G 10: 24,050,254 M249V probably benign Het
Tarm1 T C 7: 3,497,551 T79A probably benign Het
Trf A G 9: 103,222,159 F300L probably damaging Het
Vmn1r69 T A 7: 10,580,058 I170F probably damaging Het
Vmn2r105 A G 17: 20,227,479 F361S possibly damaging Het
Vmn2r79 A G 7: 87,037,319 Y636C probably damaging Het
Wdr59 T C 8: 111,504,373 N68D probably damaging Het
Zfp345 T A 2: 150,472,300 H439L probably damaging Het
Other mutations in Olfr910
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02740:Olfr910 APN 9 38538930 missense probably damaging 1.00
R0550:Olfr910 UTSW 9 38539380 missense probably damaging 0.97
R1375:Olfr910 UTSW 9 38539534 missense possibly damaging 0.63
R1698:Olfr910 UTSW 9 38539256 nonsense probably null
R2067:Olfr910 UTSW 9 38539280 missense probably benign 0.09
R2111:Olfr910 UTSW 9 38539280 missense probably benign 0.09
R2519:Olfr910 UTSW 9 38538985 missense probably damaging 0.99
R4742:Olfr910 UTSW 9 38539656 missense probably damaging 1.00
R4782:Olfr910 UTSW 9 38539075 missense probably damaging 1.00
R6491:Olfr910 UTSW 9 38647455 missense probably damaging 1.00
R7101:Olfr910 UTSW 9 38539670 missense probably benign 0.02
Z1088:Olfr910 UTSW 9 38539149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGGGATGTATGACTCAACTCTACTTC -3'
(R):5'- GGTTCATCATGGGGACCACAATGG -3'

Sequencing Primer
(F):5'- TATGTCCTGACAGCAATGGC -3'
(R):5'- GACAGAAGATACTTTCCCCTCATTC -3'
Posted On2014-02-07