Incidental Mutation 'R0096:Ksr1'
ID155838
Institutional Source Beutler Lab
Gene Symbol Ksr1
Ensembl Gene ENSMUSG00000018334
Gene Namekinase suppressor of ras 1
SynonymsD11Bhm183e, B-KSR1, D11Bhm184e
MMRRC Submission 038382-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R0096 (G1)
Quality Score72
Status Validated
Chromosome11
Chromosomal Location79013440-79146407 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 79038247 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018478] [ENSMUST00000108264] [ENSMUST00000208969] [ENSMUST00000226282]
Predicted Effect probably benign
Transcript: ENSMUST00000018478
SMART Domains Protein: ENSMUSP00000018478
Gene: ENSMUSG00000018334

DomainStartEndE-ValueType
low complexity region 8 31 N/A INTRINSIC
Pfam:KSR1-SAM 39 166 2.7e-41 PFAM
low complexity region 271 278 N/A INTRINSIC
C1 334 377 5.48e-8 SMART
low complexity region 429 464 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
Pfam:Pkinase_Tyr 563 827 2.3e-48 PFAM
Pfam:Pkinase 563 828 1.5e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108264
SMART Domains Protein: ENSMUSP00000103899
Gene: ENSMUSG00000018334

DomainStartEndE-ValueType
low complexity region 8 31 N/A INTRINSIC
Pfam:KSR1-SAM 39 166 8.9e-51 PFAM
low complexity region 271 278 N/A INTRINSIC
C1 334 377 5.48e-8 SMART
low complexity region 429 464 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
Pfam:Pkinase 563 637 1e-6 PFAM
Pfam:Pkinase_Tyr 563 637 2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208969
Predicted Effect probably benign
Transcript: ENSMUST00000226282
Meta Mutation Damage Score 0.1508 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.5%
Validation Efficiency 100% (69/69)
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibit disorganized hair follicles and a decreased susceptibility to papilloma formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A C 6: 48,931,188 Q374P probably damaging Het
4933405L10Rik A T 8: 105,708,931 probably null Het
Adamts3 G A 5: 89,701,717 Q615* probably null Het
Adamtsl3 T A 7: 82,465,699 probably benign Het
Anks1b T C 10: 90,074,062 S48P possibly damaging Het
Arfip2 T A 7: 105,638,230 K94N probably damaging Het
Arhgap42 G T 9: 9,009,313 N524K probably damaging Het
Arhgef28 T G 13: 97,931,254 T1388P probably damaging Het
Arid4b T C 13: 14,129,194 V68A probably benign Het
BC005537 T C 13: 24,805,940 F129L probably damaging Het
Capn3 A T 2: 120,502,529 H592L possibly damaging Het
Ccdc105 T A 10: 78,748,705 I328L probably benign Het
Dglucy A T 12: 100,838,651 I134F possibly damaging Het
Dhh T A 15: 98,893,988 M380L probably benign Het
Dnaic2 A C 11: 114,754,332 D531A probably benign Het
Dthd1 A T 5: 62,843,040 R568S possibly damaging Het
Efr3a A G 15: 65,855,441 N613S probably damaging Het
Epb41l5 T A 1: 119,623,911 probably benign Het
Ermp1 A G 19: 29,631,388 Y164H possibly damaging Het
Fam120c CCAGCAGCAGCAGCAGCA CCAGCAGCAGCAGCA X: 151,344,345 probably benign Het
Fbrs C T 7: 127,489,487 A145V probably damaging Het
Gm4736 T C 6: 132,115,606 noncoding transcript Het
Gm9873 A T 2: 169,021,109 noncoding transcript Het
Grik1 T C 16: 88,034,226 M219V possibly damaging Het
Gtsf1l C T 2: 163,087,536 C9Y probably damaging Het
Itih5 G A 2: 10,251,378 R885Q probably benign Het
Kdm4c A G 4: 74,357,343 E752G probably damaging Het
Lama1 T A 17: 67,805,413 F2283I probably benign Het
Luc7l3 A G 11: 94,301,494 probably benign Het
Lypd8 A T 11: 58,386,757 M122L probably benign Het
Map1a A G 2: 121,301,505 E696G probably damaging Het
Mrps34 A G 17: 24,895,669 D110G probably damaging Het
Myh11 T A 16: 14,204,367 K1710M possibly damaging Het
Myo1d A G 11: 80,484,332 L972P probably damaging Het
Nos1ap T C 1: 170,329,247 D214G probably damaging Het
Olfr1224-ps1 A T 2: 89,156,296 M293K probably benign Het
Olfr910 A T 9: 38,539,536 I214F probably damaging Het
Pate4 T G 9: 35,611,834 T5P probably damaging Het
Pygl A T 12: 70,191,166 probably benign Het
Samd4 A T 14: 47,064,297 M252L possibly damaging Het
Serpinb1c T A 13: 32,886,283 probably benign Het
Sis A T 3: 72,928,267 W921R probably damaging Het
Skint5 A T 4: 113,597,768 probably benign Het
Slc27a6 T C 18: 58,598,757 probably benign Het
Sycp2 G T 2: 178,403,735 Q31K probably damaging Het
Taar7f A G 10: 24,050,254 M249V probably benign Het
Tarm1 T C 7: 3,497,551 T79A probably benign Het
Trf A G 9: 103,222,159 F300L probably damaging Het
Vmn1r69 T A 7: 10,580,058 I170F probably damaging Het
Vmn2r105 A G 17: 20,227,479 F361S possibly damaging Het
Vmn2r79 A G 7: 87,037,319 Y636C probably damaging Het
Wdr59 T C 8: 111,504,373 N68D probably damaging Het
Zfp345 T A 2: 150,472,300 H439L probably damaging Het
Other mutations in Ksr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Ksr1 APN 11 79027517 missense probably damaging 1.00
IGL01304:Ksr1 APN 11 79027642 missense probably damaging 1.00
IGL01482:Ksr1 APN 11 79036583 missense probably damaging 1.00
IGL01928:Ksr1 APN 11 79044839 splice site probably null
IGL02025:Ksr1 APN 11 79021450 unclassified probably null
IGL02176:Ksr1 APN 11 79020791 missense probably benign 0.00
IGL02374:Ksr1 APN 11 79028491 missense probably benign 0.02
IGL02511:Ksr1 APN 11 79045220 missense possibly damaging 0.55
IGL02563:Ksr1 APN 11 79044858 missense possibly damaging 0.73
IGL02662:Ksr1 APN 11 79036725 missense probably damaging 1.00
IGL02823:Ksr1 APN 11 79021403 missense probably benign 0.35
IGL02879:Ksr1 APN 11 79074444 missense probably damaging 1.00
julius UTSW 11 79036494 critical splice donor site probably null
R0096:Ksr1 UTSW 11 79038247 splice site probably benign
R0364:Ksr1 UTSW 11 79029025 splice site probably benign
R0479:Ksr1 UTSW 11 79025283 missense probably damaging 1.00
R0590:Ksr1 UTSW 11 79045140 missense probably damaging 1.00
R0711:Ksr1 UTSW 11 79038247 splice site probably benign
R0743:Ksr1 UTSW 11 79021503 missense possibly damaging 0.79
R0884:Ksr1 UTSW 11 79021503 missense possibly damaging 0.79
R1272:Ksr1 UTSW 11 79146078 nonsense probably null
R1739:Ksr1 UTSW 11 79047305 missense probably damaging 1.00
R1885:Ksr1 UTSW 11 79020378 missense probably null
R1885:Ksr1 UTSW 11 79036521 missense probably damaging 1.00
R1886:Ksr1 UTSW 11 79020378 missense probably null
R2118:Ksr1 UTSW 11 79045193 missense probably benign 0.10
R2127:Ksr1 UTSW 11 79033313 missense probably damaging 1.00
R2939:Ksr1 UTSW 11 79045181 unclassified probably null
R4090:Ksr1 UTSW 11 79027477 missense probably damaging 1.00
R4675:Ksr1 UTSW 11 79074360 missense possibly damaging 0.81
R4854:Ksr1 UTSW 11 79027702 missense probably damaging 1.00
R5267:Ksr1 UTSW 11 79020425 missense probably damaging 1.00
R5813:Ksr1 UTSW 11 79038198 missense probably damaging 1.00
R5928:Ksr1 UTSW 11 79059719 missense probably damaging 0.96
R6199:Ksr1 UTSW 11 79020441 missense possibly damaging 0.65
R6346:Ksr1 UTSW 11 79019664 missense possibly damaging 0.93
R6377:Ksr1 UTSW 11 79036494 critical splice donor site probably null
R6885:Ksr1 UTSW 11 79047295 critical splice donor site probably null
R7016:Ksr1 UTSW 11 79027536 missense probably damaging 1.00
U24488:Ksr1 UTSW 11 79047441 missense probably damaging 1.00
Z1088:Ksr1 UTSW 11 79044879 unclassified probably null
Predicted Primers PCR Primer
(F):5'- ACTCTGATGTGACAGGAGGCCAAG -3'
(R):5'- AGAACTGCTAGATCCGAGGGTGTG -3'

Sequencing Primer
(F):5'- CAGGAGGCCAAGAATGAAATAAC -3'
(R):5'- TGCCCACTGATGCGGATTG -3'
Posted On2014-02-07