Incidental Mutation 'R1368:Cnn3'
ID155864
Institutional Source Beutler Lab
Gene Symbol Cnn3
Ensembl Gene ENSMUSG00000053931
Gene Namecalponin 3, acidic
SynonymsCalpo3, 1600014M03Rik
MMRRC Submission 039433-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R1368 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location121426497-121458207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121457137 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 189 (L189S)
Ref Sequence ENSEMBL: ENSMUSP00000142526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029773] [ENSMUST00000039197] [ENSMUST00000197135] [ENSMUST00000198393]
Predicted Effect probably benign
Transcript: ENSMUST00000029773
AA Change: L235S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029773
Gene: ENSMUSG00000053931
AA Change: L235S

DomainStartEndE-ValueType
CH 28 125 3.92e-27 SMART
Pfam:Calponin 164 188 1.1e-19 PFAM
Pfam:Calponin 204 228 7.4e-17 PFAM
Pfam:Calponin 243 267 1.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000039197
SMART Domains Protein: ENSMUSP00000040210
Gene: ENSMUSG00000039865

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 217 239 N/A INTRINSIC
transmembrane domain 244 266 N/A INTRINSIC
Pfam:Choline_transpo 291 607 2.3e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196671
Predicted Effect probably benign
Transcript: ENSMUST00000197135
AA Change: L189S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000142526
Gene: ENSMUSG00000053931
AA Change: L189S

DomainStartEndE-ValueType
CH 28 120 8.6e-10 SMART
Pfam:Calponin 158 183 1e-10 PFAM
Pfam:Calponin 197 222 9.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198335
Predicted Effect probably benign
Transcript: ENSMUST00000198393
AA Change: L138S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143186
Gene: ENSMUSG00000053931
AA Change: L138S

DomainStartEndE-ValueType
Blast:CH 1 28 7e-12 BLAST
SCOP:d1h67a_ 1 35 9e-9 SMART
PDB:1WYN|A 1 53 3e-21 PDB
Pfam:Calponin 67 92 1.2e-14 PFAM
Pfam:Calponin 107 132 3.8e-11 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000198620
AA Change: L18S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199188
Predicted Effect unknown
Transcript: ENSMUST00000199499
AA Change: L8S
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a markedly acidic C terminus; the basic N-terminus is highly homologous to the N-terminus of a related gene, CNN1. Members of the CNN gene family all contain similar tandemly repeated motifs. This encoded protein is associated with the cytoskeleton but is not involved in contraction. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe exencephaly, neuronal tissue overgrowth and die immediately postnatal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,159,478 Q2341R possibly damaging Het
9930021J03Rik C A 19: 29,716,396 S1966I probably damaging Het
Abca13 A G 11: 9,291,836 D1233G probably benign Het
Abcc8 G A 7: 46,122,860 R832W probably damaging Het
Atp10b A G 11: 43,202,154 T439A probably damaging Het
C130073F10Rik T A 4: 101,890,756 N74Y possibly damaging Het
Cct8 G A 16: 87,491,312 S124L probably damaging Het
Cdh9 T A 15: 16,848,482 probably benign Het
Cep290 C T 10: 100,494,966 probably benign Het
Chrng T A 1: 87,205,853 L10H probably damaging Het
Cog4 A G 8: 110,858,525 probably benign Het
Cxcl12 A G 6: 117,176,150 probably benign Het
Eif2b2 G A 12: 85,223,456 A257T probably damaging Het
Fam189a1 A T 7: 64,819,877 V41E probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Fktn G A 4: 53,734,880 G173R probably damaging Het
Gabbr2 T C 4: 46,674,464 N841S probably benign Het
Gm5622 T A 14: 51,662,190 V167E possibly damaging Het
Gnaq T C 19: 16,378,287 V289A probably benign Het
Gpatch2l T G 12: 86,260,665 D272E possibly damaging Het
Gzmg G A 14: 56,157,806 T74I probably benign Het
Ikzf2 G A 1: 69,539,315 A271V possibly damaging Het
Lig4 T C 8: 9,971,176 D868G possibly damaging Het
Mfsd6 T C 1: 52,708,605 E367G possibly damaging Het
Mpz T C 1: 171,159,964 L223P probably damaging Het
Muc3 T C 5: 137,146,826 probably benign Het
Olfr38 C A 6: 42,762,679 T209K possibly damaging Het
Pdcd2 G T 17: 15,526,584 N104K probably damaging Het
Pigg G T 5: 108,317,288 G129V probably damaging Het
Ppp3cc T C 14: 70,245,862 Y254C probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Psg23 A G 7: 18,614,720 V54A probably benign Het
Psmd3 A G 11: 98,682,920 D64G probably damaging Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Ptgdr T A 14: 44,853,342 I320F probably damaging Het
Rad50 T A 11: 53,683,245 K722* probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rgs9 G A 11: 109,248,151 S255L probably benign Het
Ror1 C T 4: 100,441,137 P569L possibly damaging Het
Rsad2 T C 12: 26,447,148 probably null Het
Scn8a A G 15: 101,035,541 D1501G probably damaging Het
Sema3c A G 5: 17,678,332 T313A possibly damaging Het
Serpinc1 T A 1: 160,993,524 F59L probably damaging Het
Sike1 A G 3: 102,996,184 D63G possibly damaging Het
Slc25a11 T A 11: 70,645,526 probably null Het
Slc32a1 A G 2: 158,611,320 M27V probably benign Het
Smc5 A G 19: 23,210,443 V1003A probably damaging Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Topaz1 A G 9: 122,748,250 E75G possibly damaging Het
Tspan3 A T 9: 56,147,499 V48E probably benign Het
Ugt1a6b T C 1: 88,107,636 I232T probably benign Het
Unc79 A G 12: 103,156,513 K2290E probably damaging Het
Vmn1r19 T C 6: 57,404,671 F70L probably benign Het
Other mutations in Cnn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02900:Cnn3 APN 3 121451494 missense probably benign 0.03
R0711:Cnn3 UTSW 3 121449984 missense probably benign 0.00
R0811:Cnn3 UTSW 3 121454951 missense probably damaging 1.00
R0812:Cnn3 UTSW 3 121454951 missense probably damaging 1.00
R1567:Cnn3 UTSW 3 121449958 nonsense probably null
R1675:Cnn3 UTSW 3 121457169 nonsense probably null
R2132:Cnn3 UTSW 3 121451935 missense probably damaging 0.97
R2851:Cnn3 UTSW 3 121450053 start gained probably benign
R5850:Cnn3 UTSW 3 121451928 missense probably damaging 0.99
R6936:Cnn3 UTSW 3 121450053 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGGCTCAACTCAGCAGCTCAAG -3'
(R):5'- AATCGCTATCACTGATTTCCGACCC -3'

Sequencing Primer
(F):5'- GTTAGGGTCACGTCAGAACC -3'
(R):5'- GATTTCCGACCCATTGGTGC -3'
Posted On2014-02-11