Incidental Mutation 'R1368:Gabbr2'
ID155865
Institutional Source Beutler Lab
Gene Symbol Gabbr2
Ensembl Gene ENSMUSG00000039809
Gene Namegamma-aminobutyric acid (GABA) B receptor, 2
SynonymsGpr51, Gababr2, LOC242425
MMRRC Submission 039433-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R1368 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location46662305-46991873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46674464 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 841 (N841S)
Ref Sequence ENSEMBL: ENSMUSP00000103378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107749] [ENSMUST00000205643]
Predicted Effect probably benign
Transcript: ENSMUST00000107749
AA Change: N841S

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103378
Gene: ENSMUSG00000039809
AA Change: N841S

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:Peripla_BP_6 59 434 1.5e-15 PFAM
Pfam:ANF_receptor 75 429 2e-51 PFAM
Pfam:7tm_3 492 745 6.4e-57 PFAM
PDB:4PAS|B 778 818 1e-18 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129328
Predicted Effect probably benign
Transcript: ENSMUST00000205643
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The multi-pass membrane protein encoded by this gene belongs to the G-protein coupled receptor 3 family and GABA-B receptor subfamily. The GABA-B receptors inhibit neuronal activity through G protein-coupled second-messenger systems, which regulate the release of neurotransmitters, and the activity of ion channels and adenylyl cyclase. This receptor subunit forms an active heterodimeric complex with GABA-B receptor subunit 1, neither of which is effective on its own. Allelic variants of this gene have been associated with nicotine dependence.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in clonic seizures, hyperactivity, hyperalgesia in response to thermal or mechanical stimuli, increased anxiety, and decreased depression-related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,159,478 Q2341R possibly damaging Het
9930021J03Rik C A 19: 29,716,396 S1966I probably damaging Het
Abca13 A G 11: 9,291,836 D1233G probably benign Het
Abcc8 G A 7: 46,122,860 R832W probably damaging Het
Atp10b A G 11: 43,202,154 T439A probably damaging Het
C130073F10Rik T A 4: 101,890,756 N74Y possibly damaging Het
Cct8 G A 16: 87,491,312 S124L probably damaging Het
Cdh9 T A 15: 16,848,482 probably benign Het
Cep290 C T 10: 100,494,966 probably benign Het
Chrng T A 1: 87,205,853 L10H probably damaging Het
Cnn3 T C 3: 121,457,137 L189S probably benign Het
Cog4 A G 8: 110,858,525 probably benign Het
Cxcl12 A G 6: 117,176,150 probably benign Het
Eif2b2 G A 12: 85,223,456 A257T probably damaging Het
Fam189a1 A T 7: 64,819,877 V41E probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Fktn G A 4: 53,734,880 G173R probably damaging Het
Gm5622 T A 14: 51,662,190 V167E possibly damaging Het
Gnaq T C 19: 16,378,287 V289A probably benign Het
Gpatch2l T G 12: 86,260,665 D272E possibly damaging Het
Gzmg G A 14: 56,157,806 T74I probably benign Het
Ikzf2 G A 1: 69,539,315 A271V possibly damaging Het
Lig4 T C 8: 9,971,176 D868G possibly damaging Het
Mfsd6 T C 1: 52,708,605 E367G possibly damaging Het
Mpz T C 1: 171,159,964 L223P probably damaging Het
Muc3 T C 5: 137,146,826 probably benign Het
Olfr38 C A 6: 42,762,679 T209K possibly damaging Het
Pdcd2 G T 17: 15,526,584 N104K probably damaging Het
Pigg G T 5: 108,317,288 G129V probably damaging Het
Ppp3cc T C 14: 70,245,862 Y254C probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Psg23 A G 7: 18,614,720 V54A probably benign Het
Psmd3 A G 11: 98,682,920 D64G probably damaging Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Ptgdr T A 14: 44,853,342 I320F probably damaging Het
Rad50 T A 11: 53,683,245 K722* probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rgs9 G A 11: 109,248,151 S255L probably benign Het
Ror1 C T 4: 100,441,137 P569L possibly damaging Het
Rsad2 T C 12: 26,447,148 probably null Het
Scn8a A G 15: 101,035,541 D1501G probably damaging Het
Sema3c A G 5: 17,678,332 T313A possibly damaging Het
Serpinc1 T A 1: 160,993,524 F59L probably damaging Het
Sike1 A G 3: 102,996,184 D63G possibly damaging Het
Slc25a11 T A 11: 70,645,526 probably null Het
Slc32a1 A G 2: 158,611,320 M27V probably benign Het
Smc5 A G 19: 23,210,443 V1003A probably damaging Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Topaz1 A G 9: 122,748,250 E75G possibly damaging Het
Tspan3 A T 9: 56,147,499 V48E probably benign Het
Ugt1a6b T C 1: 88,107,636 I232T probably benign Het
Unc79 A G 12: 103,156,513 K2290E probably damaging Het
Vmn1r19 T C 6: 57,404,671 F70L probably benign Het
Other mutations in Gabbr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Gabbr2 APN 4 46787600 missense probably damaging 1.00
IGL00844:Gabbr2 APN 4 46875711 missense probably damaging 1.00
IGL01584:Gabbr2 APN 4 46674524 missense probably damaging 0.97
IGL01684:Gabbr2 APN 4 46736501 missense probably benign
IGL01884:Gabbr2 APN 4 46875711 missense probably damaging 1.00
IGL02073:Gabbr2 APN 4 46667547 missense probably benign 0.00
IGL02376:Gabbr2 APN 4 46684300 missense probably damaging 1.00
R0194:Gabbr2 UTSW 4 46787565 missense possibly damaging 0.48
R0627:Gabbr2 UTSW 4 46681223 missense possibly damaging 0.92
R0685:Gabbr2 UTSW 4 46787521 missense possibly damaging 0.64
R0781:Gabbr2 UTSW 4 46718838 missense probably damaging 1.00
R0882:Gabbr2 UTSW 4 46718904 missense probably damaging 1.00
R0883:Gabbr2 UTSW 4 46677474 missense probably benign 0.00
R1004:Gabbr2 UTSW 4 46677544 missense possibly damaging 0.60
R1078:Gabbr2 UTSW 4 46664833 missense probably damaging 0.99
R1110:Gabbr2 UTSW 4 46718838 missense probably damaging 1.00
R1557:Gabbr2 UTSW 4 46846436 missense probably damaging 1.00
R1577:Gabbr2 UTSW 4 46684319 missense probably benign 0.29
R1645:Gabbr2 UTSW 4 46664963 splice site probably null
R1743:Gabbr2 UTSW 4 46677603 missense possibly damaging 0.47
R1848:Gabbr2 UTSW 4 46739823 missense probably benign 0.31
R1997:Gabbr2 UTSW 4 46787502 missense probably damaging 1.00
R2009:Gabbr2 UTSW 4 46734119 missense probably damaging 1.00
R4021:Gabbr2 UTSW 4 46846435 missense probably damaging 1.00
R4719:Gabbr2 UTSW 4 46718797 missense probably damaging 0.99
R4757:Gabbr2 UTSW 4 46875675 missense probably damaging 0.98
R4798:Gabbr2 UTSW 4 46991139 missense possibly damaging 0.92
R5086:Gabbr2 UTSW 4 46724342 missense probably damaging 1.00
R5176:Gabbr2 UTSW 4 46681208 missense probably damaging 0.99
R5451:Gabbr2 UTSW 4 46684294 missense probably benign 0.15
R5510:Gabbr2 UTSW 4 46734113 missense probably damaging 1.00
R5611:Gabbr2 UTSW 4 46804105 missense probably damaging 0.98
R6049:Gabbr2 UTSW 4 46787641 missense probably damaging 1.00
R6089:Gabbr2 UTSW 4 46846448 missense probably damaging 1.00
R6118:Gabbr2 UTSW 4 46736459 missense probably damaging 1.00
R6209:Gabbr2 UTSW 4 46804069 missense probably damaging 1.00
R6212:Gabbr2 UTSW 4 46681189 missense probably damaging 0.98
R6717:Gabbr2 UTSW 4 46787574 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AAAGTGTGTCCCTGTCAGAACACTG -3'
(R):5'- AGCTCCTGCTTGAATGAGTGCAAC -3'

Sequencing Primer
(F):5'- AGCTCTGCTGTGAACAAGC -3'
(R):5'- cggaaggcagaggcagg -3'
Posted On2014-02-11