Incidental Mutation 'R1368:Fktn'
ID155866
Institutional Source Beutler Lab
Gene Symbol Fktn
Ensembl Gene ENSMUSG00000028414
Gene Namefukutin
SynonymsFukutin, Fcmd
MMRRC Submission 039433-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1368 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location53713998-53777890 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 53734880 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 173 (G173R)
Ref Sequence ENSEMBL: ENSMUSP00000152867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061771] [ENSMUST00000107638] [ENSMUST00000128667] [ENSMUST00000221657] [ENSMUST00000222290]
Predicted Effect probably damaging
Transcript: ENSMUST00000061771
AA Change: G134R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061489
Gene: ENSMUSG00000028414
AA Change: G134R

DomainStartEndE-ValueType
transmembrane domain 7 28 N/A INTRINSIC
Pfam:LicD 288 393 2.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107638
SMART Domains Protein: ENSMUSP00000138774
Gene: ENSMUSG00000028414

DomainStartEndE-ValueType
transmembrane domain 7 28 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128667
AA Change: G134R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114699
Gene: ENSMUSG00000028414
AA Change: G134R

DomainStartEndE-ValueType
transmembrane domain 7 28 N/A INTRINSIC
Pfam:LicD 288 393 2.4e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000221657
AA Change: G173R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222290
Meta Mutation Damage Score 0.52 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative transmembrane protein that is localized to the cis-Golgi compartment, where it may be involved in the glycosylation of alpha-dystroglycan in skeletal muscle. The encoded protein is thought to be a glycosyltransferase and could play a role in brain development. Defects in this gene are a cause of Fukuyama-type congenital muscular dystrophy (FCMD), Walker-Warburg syndrome (WWS), limb-girdle muscular dystrophy type 2M (LGMD2M), and dilated cardiomyopathy type 1X (CMD1X). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null mice die by E9.5. Embryos exhibit diverse phenotypes such as growth retardation, folding of the egg cylinder, leakage of maternal red blood cells into the yolk sac cavity, increased number of apoptotic cells in the ectoderm, and thin and breached basement membranes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,159,478 Q2341R possibly damaging Het
9930021J03Rik C A 19: 29,716,396 S1966I probably damaging Het
Abca13 A G 11: 9,291,836 D1233G probably benign Het
Abcc8 G A 7: 46,122,860 R832W probably damaging Het
Atp10b A G 11: 43,202,154 T439A probably damaging Het
C130073F10Rik T A 4: 101,890,756 N74Y possibly damaging Het
Cct8 G A 16: 87,491,312 S124L probably damaging Het
Cdh9 T A 15: 16,848,482 probably benign Het
Cep290 C T 10: 100,494,966 probably benign Het
Chrng T A 1: 87,205,853 L10H probably damaging Het
Cnn3 T C 3: 121,457,137 L189S probably benign Het
Cog4 A G 8: 110,858,525 probably benign Het
Cxcl12 A G 6: 117,176,150 probably benign Het
Eif2b2 G A 12: 85,223,456 A257T probably damaging Het
Fam189a1 A T 7: 64,819,877 V41E probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gabbr2 T C 4: 46,674,464 N841S probably benign Het
Gm5622 T A 14: 51,662,190 V167E possibly damaging Het
Gnaq T C 19: 16,378,287 V289A probably benign Het
Gpatch2l T G 12: 86,260,665 D272E possibly damaging Het
Gzmg G A 14: 56,157,806 T74I probably benign Het
Ikzf2 G A 1: 69,539,315 A271V possibly damaging Het
Lig4 T C 8: 9,971,176 D868G possibly damaging Het
Mfsd6 T C 1: 52,708,605 E367G possibly damaging Het
Mpz T C 1: 171,159,964 L223P probably damaging Het
Muc3 T C 5: 137,146,826 probably benign Het
Olfr38 C A 6: 42,762,679 T209K possibly damaging Het
Pdcd2 G T 17: 15,526,584 N104K probably damaging Het
Pigg G T 5: 108,317,288 G129V probably damaging Het
Ppp3cc T C 14: 70,245,862 Y254C probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Psg23 A G 7: 18,614,720 V54A probably benign Het
Psmd3 A G 11: 98,682,920 D64G probably damaging Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Ptgdr T A 14: 44,853,342 I320F probably damaging Het
Rad50 T A 11: 53,683,245 K722* probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rgs9 G A 11: 109,248,151 S255L probably benign Het
Ror1 C T 4: 100,441,137 P569L possibly damaging Het
Rsad2 T C 12: 26,447,148 probably null Het
Scn8a A G 15: 101,035,541 D1501G probably damaging Het
Sema3c A G 5: 17,678,332 T313A possibly damaging Het
Serpinc1 T A 1: 160,993,524 F59L probably damaging Het
Sike1 A G 3: 102,996,184 D63G possibly damaging Het
Slc25a11 T A 11: 70,645,526 probably null Het
Slc32a1 A G 2: 158,611,320 M27V probably benign Het
Smc5 A G 19: 23,210,443 V1003A probably damaging Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Topaz1 A G 9: 122,748,250 E75G possibly damaging Het
Tspan3 A T 9: 56,147,499 V48E probably benign Het
Ugt1a6b T C 1: 88,107,636 I232T probably benign Het
Unc79 A G 12: 103,156,513 K2290E probably damaging Het
Vmn1r19 T C 6: 57,404,671 F70L probably benign Het
Other mutations in Fktn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Fktn APN 4 53734866 missense probably benign 0.17
IGL00562:Fktn APN 4 53747007 critical splice acceptor site probably null
IGL00563:Fktn APN 4 53747007 critical splice acceptor site probably null
IGL00972:Fktn APN 4 53734992 missense probably damaging 1.00
IGL01025:Fktn APN 4 53737568 missense possibly damaging 0.51
IGL02329:Fktn APN 4 53720181 missense probably benign 0.40
IGL03149:Fktn APN 4 53744653 missense probably benign
IGL03310:Fktn APN 4 53720120 nonsense probably null
beijing UTSW 4 53734880 missense probably damaging 1.00
R0257:Fktn UTSW 4 53734898 missense probably benign 0.09
R0311:Fktn UTSW 4 53744620 missense probably benign 0.10
R1500:Fktn UTSW 4 53735065 missense probably benign
R1654:Fktn UTSW 4 53761220 missense probably benign 0.01
R1757:Fktn UTSW 4 53747003 splice site probably benign
R2007:Fktn UTSW 4 53735099 missense possibly damaging 0.56
R4308:Fktn UTSW 4 53724617 intron probably benign
R4374:Fktn UTSW 4 53720201 missense probably damaging 0.99
R4798:Fktn UTSW 4 53744637 missense probably benign 0.01
R5563:Fktn UTSW 4 53761327 missense probably damaging 1.00
R5913:Fktn UTSW 4 53735035 nonsense probably null
R5997:Fktn UTSW 4 53735061 missense probably benign 0.00
R6227:Fktn UTSW 4 53731136 missense probably benign
R6942:Fktn UTSW 4 53735128 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGGACAGTCTCCATTCTCCACAG -3'
(R):5'- TTGAGTCGTAGGTGACCATGCCAG -3'

Sequencing Primer
(F):5'- CACAGCTTTCTTTTGCTACTTTAG -3'
(R):5'- TGACCATGCCAGAGGTAGTTG -3'
Posted On2014-02-11