Incidental Mutation 'R1368:Ror1'
ID155867
Institutional Source Beutler Lab
Gene Symbol Ror1
Ensembl Gene ENSMUSG00000035305
Gene Namereceptor tyrosine kinase-like orphan receptor 1
Synonyms2810404D04Rik, Ntrkr1
MMRRC Submission 039433-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1368 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location100095791-100444765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100441137 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 569 (P569L)
Ref Sequence ENSEMBL: ENSMUSP00000048171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039630]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039630
AA Change: P569L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048171
Gene: ENSMUSG00000035305
AA Change: P569L

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 70 138 8.37e-15 SMART
Pfam:Fz 170 290 4.9e-13 PFAM
KR 311 393 7.57e-47 SMART
transmembrane domain 404 426 N/A INTRINSIC
TyrKc 473 746 2.46e-137 SMART
low complexity region 753 762 N/A INTRINSIC
low complexity region 817 828 N/A INTRINSIC
low complexity region 849 864 N/A INTRINSIC
Meta Mutation Damage Score 0.434 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: This gene encodes a receptor tyrosine kinase that has been implicated in nervous system development, specifically in the maintenance of neural progenitor cell fate, neurite extension and synapse formation. The encoded protein, likely a pseudokinase that lacks catalytic activity, may also regulate adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first day after birth from respiratory defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,159,478 Q2341R possibly damaging Het
9930021J03Rik C A 19: 29,716,396 S1966I probably damaging Het
Abca13 A G 11: 9,291,836 D1233G probably benign Het
Abcc8 G A 7: 46,122,860 R832W probably damaging Het
Atp10b A G 11: 43,202,154 T439A probably damaging Het
C130073F10Rik T A 4: 101,890,756 N74Y possibly damaging Het
Cct8 G A 16: 87,491,312 S124L probably damaging Het
Cdh9 T A 15: 16,848,482 probably benign Het
Cep290 C T 10: 100,494,966 probably benign Het
Chrng T A 1: 87,205,853 L10H probably damaging Het
Cnn3 T C 3: 121,457,137 L189S probably benign Het
Cog4 A G 8: 110,858,525 probably benign Het
Cxcl12 A G 6: 117,176,150 probably benign Het
Eif2b2 G A 12: 85,223,456 A257T probably damaging Het
Fam189a1 A T 7: 64,819,877 V41E probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Fktn G A 4: 53,734,880 G173R probably damaging Het
Gabbr2 T C 4: 46,674,464 N841S probably benign Het
Gm5622 T A 14: 51,662,190 V167E possibly damaging Het
Gnaq T C 19: 16,378,287 V289A probably benign Het
Gpatch2l T G 12: 86,260,665 D272E possibly damaging Het
Gzmg G A 14: 56,157,806 T74I probably benign Het
Ikzf2 G A 1: 69,539,315 A271V possibly damaging Het
Lig4 T C 8: 9,971,176 D868G possibly damaging Het
Mfsd6 T C 1: 52,708,605 E367G possibly damaging Het
Mpz T C 1: 171,159,964 L223P probably damaging Het
Muc3 T C 5: 137,146,826 probably benign Het
Olfr38 C A 6: 42,762,679 T209K possibly damaging Het
Pdcd2 G T 17: 15,526,584 N104K probably damaging Het
Pigg G T 5: 108,317,288 G129V probably damaging Het
Ppp3cc T C 14: 70,245,862 Y254C probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Psg23 A G 7: 18,614,720 V54A probably benign Het
Psmd3 A G 11: 98,682,920 D64G probably damaging Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Ptgdr T A 14: 44,853,342 I320F probably damaging Het
Rad50 T A 11: 53,683,245 K722* probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rgs9 G A 11: 109,248,151 S255L probably benign Het
Rsad2 T C 12: 26,447,148 probably null Het
Scn8a A G 15: 101,035,541 D1501G probably damaging Het
Sema3c A G 5: 17,678,332 T313A possibly damaging Het
Serpinc1 T A 1: 160,993,524 F59L probably damaging Het
Sike1 A G 3: 102,996,184 D63G possibly damaging Het
Slc25a11 T A 11: 70,645,526 probably null Het
Slc32a1 A G 2: 158,611,320 M27V probably benign Het
Smc5 A G 19: 23,210,443 V1003A probably damaging Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Topaz1 A G 9: 122,748,250 E75G possibly damaging Het
Tspan3 A T 9: 56,147,499 V48E probably benign Het
Ugt1a6b T C 1: 88,107,636 I232T probably benign Het
Unc79 A G 12: 103,156,513 K2290E probably damaging Het
Vmn1r19 T C 6: 57,404,671 F70L probably benign Het
Other mutations in Ror1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Ror1 APN 4 100333743 missense probably damaging 1.00
IGL00939:Ror1 APN 4 100441226 missense probably benign 0.01
IGL01408:Ror1 APN 4 100333787 missense probably damaging 1.00
IGL01678:Ror1 APN 4 100425968 missense possibly damaging 0.68
IGL01700:Ror1 APN 4 100409771 missense probably damaging 1.00
IGL01985:Ror1 APN 4 100425964 missense possibly damaging 0.94
IGL02002:Ror1 APN 4 100441184 missense probably damaging 1.00
IGL02634:Ror1 APN 4 100426110 missense probably benign 0.00
IGL02995:Ror1 APN 4 100334525 splice site probably benign
IGL03033:Ror1 APN 4 100411895 missense possibly damaging 0.67
IGL03207:Ror1 APN 4 100407945 splice site probably null
F5770:Ror1 UTSW 4 100440933 missense probably damaging 0.99
R0256:Ror1 UTSW 4 100409745 missense probably benign 0.20
R0417:Ror1 UTSW 4 100412000 missense possibly damaging 0.94
R0525:Ror1 UTSW 4 100441520 missense probably damaging 1.00
R1034:Ror1 UTSW 4 100333620 nonsense probably null
R1278:Ror1 UTSW 4 100441878 missense possibly damaging 0.69
R1437:Ror1 UTSW 4 100412109 missense probably benign
R1441:Ror1 UTSW 4 100440983 missense probably benign
R1544:Ror1 UTSW 4 100441986 missense probably damaging 1.00
R1717:Ror1 UTSW 4 100302938 missense probably benign
R1857:Ror1 UTSW 4 100441503 missense probably damaging 1.00
R2018:Ror1 UTSW 4 100407841 nonsense probably null
R2051:Ror1 UTSW 4 100407868 nonsense probably null
R2127:Ror1 UTSW 4 100442093 missense probably benign
R2132:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2133:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2176:Ror1 UTSW 4 100441874 missense probably damaging 0.99
R2431:Ror1 UTSW 4 100441155 missense probably damaging 1.00
R2896:Ror1 UTSW 4 100096280 missense unknown
R3005:Ror1 UTSW 4 100441764 missense probably damaging 0.99
R3780:Ror1 UTSW 4 100412117 missense probably benign 0.34
R3850:Ror1 UTSW 4 100442160 missense possibly damaging 0.90
R3861:Ror1 UTSW 4 100407923 missense possibly damaging 0.46
R4599:Ror1 UTSW 4 100407910 missense probably damaging 0.99
R4863:Ror1 UTSW 4 100409804 missense probably damaging 0.99
R4871:Ror1 UTSW 4 100425998 missense probably benign
R4990:Ror1 UTSW 4 100441964 missense probably benign
R5023:Ror1 UTSW 4 100425932 missense probably benign 0.01
R5028:Ror1 UTSW 4 100411936 missense possibly damaging 0.67
R5079:Ror1 UTSW 4 100441422 missense probably damaging 1.00
R5294:Ror1 UTSW 4 100425938 missense probably benign 0.00
R5538:Ror1 UTSW 4 100441011 missense probably benign
R6339:Ror1 UTSW 4 100411931 missense possibly damaging 0.91
R6491:Ror1 UTSW 4 100409912 missense possibly damaging 0.94
R6632:Ror1 UTSW 4 100442106 missense probably benign
R6733:Ror1 UTSW 4 100426055 missense probably benign
V7580:Ror1 UTSW 4 100440933 missense probably damaging 0.99
V7583:Ror1 UTSW 4 100440933 missense probably damaging 0.99
X0020:Ror1 UTSW 4 100426090 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCCCAGCAGTGGACAGAATTTCAAC -3'
(R):5'- TTGCCGTACATGATGGCCTCAG -3'

Sequencing Primer
(F):5'- GAATTTCAACAGGAAGCCTCTCTC -3'
(R):5'- GGCAGTGAAGACTTACTCTGTACC -3'
Posted On2014-02-11