Incidental Mutation 'R1368:Muc3'
Institutional Source Beutler Lab
Gene Symbol Muc3
Ensembl Gene ENSMUSG00000037390
Gene Namemucin 3, intestinal
MMRRC Submission 039433-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.015) question?
Stock #R1368 (G1)
Quality Score225
Status Validated
Chromosomal Location137134922-137149322 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 137146826 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041226]
Predicted Effect probably benign
Transcript: ENSMUST00000041226
SMART Domains Protein: ENSMUSP00000045196
Gene: ENSMUSG00000037390

low complexity region 1 62 N/A INTRINSIC
EGF_like 85 118 3.64e1 SMART
SEA 128 241 3.05e-32 SMART
EGF_like 290 331 3.72e1 SMART
transmembrane domain 340 362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,159,478 Q2341R possibly damaging Het
9930021J03Rik C A 19: 29,716,396 S1966I probably damaging Het
Abca13 A G 11: 9,291,836 D1233G probably benign Het
Abcc8 G A 7: 46,122,860 R832W probably damaging Het
Atp10b A G 11: 43,202,154 T439A probably damaging Het
C130073F10Rik T A 4: 101,890,756 N74Y possibly damaging Het
Cct8 G A 16: 87,491,312 S124L probably damaging Het
Cdh9 T A 15: 16,848,482 probably benign Het
Cep290 C T 10: 100,494,966 probably benign Het
Chrng T A 1: 87,205,853 L10H probably damaging Het
Cnn3 T C 3: 121,457,137 L189S probably benign Het
Cog4 A G 8: 110,858,525 probably benign Het
Cxcl12 A G 6: 117,176,150 probably benign Het
Eif2b2 G A 12: 85,223,456 A257T probably damaging Het
Fam189a1 A T 7: 64,819,877 V41E probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Fktn G A 4: 53,734,880 G173R probably damaging Het
Gabbr2 T C 4: 46,674,464 N841S probably benign Het
Gm5622 T A 14: 51,662,190 V167E possibly damaging Het
Gnaq T C 19: 16,378,287 V289A probably benign Het
Gpatch2l T G 12: 86,260,665 D272E possibly damaging Het
Gzmg G A 14: 56,157,806 T74I probably benign Het
Ikzf2 G A 1: 69,539,315 A271V possibly damaging Het
Lig4 T C 8: 9,971,176 D868G possibly damaging Het
Mfsd6 T C 1: 52,708,605 E367G possibly damaging Het
Mpz T C 1: 171,159,964 L223P probably damaging Het
Olfr38 C A 6: 42,762,679 T209K possibly damaging Het
Pdcd2 G T 17: 15,526,584 N104K probably damaging Het
Pigg G T 5: 108,317,288 G129V probably damaging Het
Ppp3cc T C 14: 70,245,862 Y254C probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Psg23 A G 7: 18,614,720 V54A probably benign Het
Psmd3 A G 11: 98,682,920 D64G probably damaging Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Ptgdr T A 14: 44,853,342 I320F probably damaging Het
Rad50 T A 11: 53,683,245 K722* probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rgs9 G A 11: 109,248,151 S255L probably benign Het
Ror1 C T 4: 100,441,137 P569L possibly damaging Het
Rsad2 T C 12: 26,447,148 probably null Het
Scn8a A G 15: 101,035,541 D1501G probably damaging Het
Sema3c A G 5: 17,678,332 T313A possibly damaging Het
Serpinc1 T A 1: 160,993,524 F59L probably damaging Het
Sike1 A G 3: 102,996,184 D63G possibly damaging Het
Slc25a11 T A 11: 70,645,526 probably null Het
Slc32a1 A G 2: 158,611,320 M27V probably benign Het
Smc5 A G 19: 23,210,443 V1003A probably damaging Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Topaz1 A G 9: 122,748,250 E75G possibly damaging Het
Tspan3 A T 9: 56,147,499 V48E probably benign Het
Ugt1a6b T C 1: 88,107,636 I232T probably benign Het
Unc79 A G 12: 103,156,513 K2290E probably damaging Het
Vmn1r19 T C 6: 57,404,671 F70L probably benign Het
Other mutations in Muc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Muc3 APN 5 137137123 nonsense probably null
R0256:Muc3 UTSW 5 137146691 missense probably damaging 1.00
R0884:Muc3 UTSW 5 137142298 missense possibly damaging 0.88
R1456:Muc3 UTSW 5 137137951 missense probably benign 0.01
R1670:Muc3 UTSW 5 137143995 missense probably benign 0.22
R2401:Muc3 UTSW 5 137154041 unclassified probably benign
R2698:Muc3 UTSW 5 137146636 missense probably damaging 0.99
R4637:Muc3 UTSW 5 137146654 missense probably damaging 0.98
R5128:Muc3 UTSW 5 137138186 critical splice donor site probably null
R5323:Muc3 UTSW 5 137146689 nonsense probably null
R5601:Muc3 UTSW 5 137138015 missense probably damaging 1.00
R5967:Muc3 UTSW 5 137146637 missense probably benign 0.03
R6480:Muc3 UTSW 5 137142390 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tgaggcaagaccgttgaaag -3'
Posted On2014-02-11