Incidental Mutation 'R1368:Tspan3'
ID155883
Institutional Source Beutler Lab
Gene Symbol Tspan3
Ensembl Gene ENSMUSG00000032324
Gene Nametetraspanin 3
SynonymsTM4-A, tetraspanin, Tm4sf8, tetraspanin TM4-A homolog, Tspan-3, 1700055K04Rik
MMRRC Submission 039433-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R1368 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location56131725-56165477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56147499 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 48 (V48E)
Ref Sequence ENSEMBL: ENSMUSP00000034876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034876] [ENSMUST00000215906] [ENSMUST00000216320]
Predicted Effect probably benign
Transcript: ENSMUST00000034876
AA Change: V48E

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034876
Gene: ENSMUSG00000032324
AA Change: V48E

DomainStartEndE-ValueType
Pfam:Tetraspannin 7 237 1.2e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214970
Predicted Effect probably benign
Transcript: ENSMUST00000215906
AA Change: V51E

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216317
Predicted Effect probably benign
Transcript: ENSMUST00000216320
AA Change: V88E

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. The use of alternate polyadenylation sites has been found for this gene. Multiple alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased hematopoietic stem cell number and decreased leukemia incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,159,478 Q2341R possibly damaging Het
9930021J03Rik C A 19: 29,716,396 S1966I probably damaging Het
Abca13 A G 11: 9,291,836 D1233G probably benign Het
Abcc8 G A 7: 46,122,860 R832W probably damaging Het
Atp10b A G 11: 43,202,154 T439A probably damaging Het
C130073F10Rik T A 4: 101,890,756 N74Y possibly damaging Het
Cct8 G A 16: 87,491,312 S124L probably damaging Het
Cdh9 T A 15: 16,848,482 probably benign Het
Cep290 C T 10: 100,494,966 probably benign Het
Chrng T A 1: 87,205,853 L10H probably damaging Het
Cnn3 T C 3: 121,457,137 L189S probably benign Het
Cog4 A G 8: 110,858,525 probably benign Het
Cxcl12 A G 6: 117,176,150 probably benign Het
Eif2b2 G A 12: 85,223,456 A257T probably damaging Het
Fam189a1 A T 7: 64,819,877 V41E probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Fktn G A 4: 53,734,880 G173R probably damaging Het
Gabbr2 T C 4: 46,674,464 N841S probably benign Het
Gm5622 T A 14: 51,662,190 V167E possibly damaging Het
Gnaq T C 19: 16,378,287 V289A probably benign Het
Gpatch2l T G 12: 86,260,665 D272E possibly damaging Het
Gzmg G A 14: 56,157,806 T74I probably benign Het
Ikzf2 G A 1: 69,539,315 A271V possibly damaging Het
Lig4 T C 8: 9,971,176 D868G possibly damaging Het
Mfsd6 T C 1: 52,708,605 E367G possibly damaging Het
Mpz T C 1: 171,159,964 L223P probably damaging Het
Muc3 T C 5: 137,146,826 probably benign Het
Olfr38 C A 6: 42,762,679 T209K possibly damaging Het
Pdcd2 G T 17: 15,526,584 N104K probably damaging Het
Pigg G T 5: 108,317,288 G129V probably damaging Het
Ppp3cc T C 14: 70,245,862 Y254C probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Psg23 A G 7: 18,614,720 V54A probably benign Het
Psmd3 A G 11: 98,682,920 D64G probably damaging Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Ptgdr T A 14: 44,853,342 I320F probably damaging Het
Rad50 T A 11: 53,683,245 K722* probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rgs9 G A 11: 109,248,151 S255L probably benign Het
Ror1 C T 4: 100,441,137 P569L possibly damaging Het
Rsad2 T C 12: 26,447,148 probably null Het
Scn8a A G 15: 101,035,541 D1501G probably damaging Het
Sema3c A G 5: 17,678,332 T313A possibly damaging Het
Serpinc1 T A 1: 160,993,524 F59L probably damaging Het
Sike1 A G 3: 102,996,184 D63G possibly damaging Het
Slc25a11 T A 11: 70,645,526 probably null Het
Slc32a1 A G 2: 158,611,320 M27V probably benign Het
Smc5 A G 19: 23,210,443 V1003A probably damaging Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Topaz1 A G 9: 122,748,250 E75G possibly damaging Het
Ugt1a6b T C 1: 88,107,636 I232T probably benign Het
Unc79 A G 12: 103,156,513 K2290E probably damaging Het
Vmn1r19 T C 6: 57,404,671 F70L probably benign Het
Other mutations in Tspan3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02880:Tspan3 APN 9 56146516 missense possibly damaging 0.78
R0585:Tspan3 UTSW 9 56145932 splice site probably benign
R0608:Tspan3 UTSW 9 56147385 critical splice donor site probably null
R1067:Tspan3 UTSW 9 56160820 missense probably benign 0.01
R4673:Tspan3 UTSW 9 56136696 missense probably damaging 1.00
R6727:Tspan3 UTSW 9 56147440 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCCCTCCATAGTCTGACATTGG -3'
(R):5'- CAATAATGCTTTCTGCACCCGTGAC -3'

Sequencing Primer
(F):5'- CTCCATAGTCTGACATTGGAGAGTG -3'
(R):5'- atagagcccagcacatcac -3'
Posted On2014-02-11